Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__11608716_10
          See other AR GT Assays ›
          SNP ID:
          rs6152
          Gene
          AR
          Gene Name
          androgen receptor
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.X: 67545785 - 67545785 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GCAGCAGCAGCGGGAGAGCGAGGGA[A/G]GCCTCGGGGGCTCCCACTTCCTCCA

          Assay ID C__11608716_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 313700

          Literature Links:

          AR PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.18)
          (0.82)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          G (0.29)
          (0.71)
          SAS
          A (0.07)
          (0.93)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.49)
          (0.51)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.11)
          (0.89)
          AMR
          A (0.10)
          (0.90)
          AR - androgen receptor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000044.3 1754 Silent Mutation GAA,GAG E,E 213 NP_000035.2
          NM_001011645.2 1754 Intron NP_001011645.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          transcription, DNA-templated
          transcription initiation from RNA polymerase II promoter
          transport
          signal transduction
          cell-cell signaling
          sex differentiation
          cell proliferation
          positive regulation of cell proliferation
          negative regulation of cell proliferation
          positive regulation of gene expression
          cell growth
          androgen receptor signaling pathway
          intracellular receptor signaling pathway
          prostate gland development
          positive regulation of phosphorylation
          positive regulation of cell differentiation
          negative regulation of integrin biosynthetic process
          positive regulation of integrin biosynthetic process
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of transcription from RNA polymerase III promoter
          positive regulation of NF-kappaB transcription factor activity
          protein oligomerization
          regulation of establishment of protein localization to plasma membrane
          negative regulation of extrinsic apoptotic signaling pathway
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          RNA polymerase II transcription factor binding
          DNA binding
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          RNA polymerase II transcription factor activity, ligand-activated sequence-specific DNA binding
          androgen receptor activity
          receptor binding
          steroid binding
          androgen binding
          protein binding
          beta-catenin binding
          transcription factor binding
          zinc ion binding
          enzyme binding
          transcription regulatory region DNA binding
          protein dimerization activity
          ATPase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline