Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Quem atendemos
    • Setor de Biotecnologia
    • Indústria Biofarmacêutica
    • CDMO
    • Diagnósticos Laboratoriais
    • Ciência Industrial e Aplicada
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__11647753_20
          See other GATA3 GT Assays ›
          SNP ID:
          rs485411
          Gene
          GATA3 GATA3-AS1
          Gene Name
          GATA binding protein 3
          GATA3 antisense RNA 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 8051222 - 8051222 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GTGTGGTAGCTTAACCCCTACCGAG[C/T]GGAGAAAGTCCGGCTCCATTTCTCA

          Assay ID C__11647753_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 131320

          Literature Links:

          GATA3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.12)
          (0.88)
          Caucasian - Not Available CEPH (CEU)
          T (0.28)
          (0.72)
          EAS
          T (0.04)
          (0.96)
          African American - Not Available YRI (Yoruba)
          T (0.09)
          (0.91)
          SAS
          T (0.09)
          (0.91)
          Chinese - Not Available JPT (Japanese)
          T (0.07)
          (0.93)
          AFR
          T (0.09)
          (0.91)
          Japanese - Not Available CHB (Han Chinese)
          T (0.04)
          (0.96)
          EUR
          T (0.23)
          (0.77)
          AMR
          T (0.14)
          (0.86)
          GATA3 - GATA binding protein 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001002295.1 Intron NP_001002295.1
          NM_002051.2 Intron NP_002042.1
          XM_005252442.2 Intron XP_005252499.1
          XM_005252443.4 Intron XP_005252500.1
          GATA3-AS1 - GATA3 antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          DNA-binding transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          in utero embryonic development
          cell fate determination
          neuron migration
          type IV hypersensitivity
          kidney development
          mesonephros development
          lens development in camera-type eye
          pro-T cell differentiation
          aortic valve morphogenesis
          cardiac right ventricle morphogenesis
          ventricular septum development
          chromatin remodeling
          transcription from RNA polymerase II promoter
          defense response
          humoral immune response
          signal transduction
          axon guidance
          heart development
          blood coagulation
          negative regulation of cell proliferation
          male gonad development
          response to virus
          anatomical structure morphogenesis
          post-embryonic development
          organ morphogenesis
          positive regulation of signal transduction
          response to gamma radiation
          positive regulation of endothelial cell migration
          regulation of neuron projection development
          phosphatidylinositol 3-kinase signaling
          erythrocyte differentiation
          TOR signaling
          negative regulation of interferon-gamma production
          negative regulation of interleukin-2 production
          positive regulation of interleukin-4 production
          negative regulation of mammary gland epithelial cell proliferation
          embryonic hemopoiesis
          cellular response to interferon-alpha
          ureter maturation
          parathyroid hormone secretion
          regulation of cytokine biosynthetic process
          norepinephrine biosynthetic process
          inner ear morphogenesis
          response to drug
          regulation of CD4-positive, alpha-beta T cell differentiation
          regulation of neuron apoptotic process
          ear development
          response to estrogen
          thymic T cell selection
          T-helper 2 cell differentiation
          innate immune response
          cell fate commitment
          response to ethanol
          positive regulation of T cell differentiation
          negative regulation of fat cell differentiation
          negative regulation of cell cycle
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          cell maturation
          sympathetic nervous system development
          thymus development
          digestive tract development
          developmental growth
          anatomical structure formation involved in morphogenesis
          negative regulation of inflammatory response
          T cell receptor signaling pathway
          regulation of histone H3-K4 methylation
          positive regulation of protein kinase B signaling
          parathyroid gland development
          pharyngeal system development
          uterus development
          mesenchymal to epithelial transition
          mast cell differentiation
          ureteric bud formation
          regulation of histone H3-K27 methylation
          canonical Wnt signaling pathway involved in metanephric kidney development
          cellular response to interleukin-4
          cellular response to tumor necrosis factor
          positive regulation of histone H3-K14 acetylation
          otic vesicle development
          cellular response to BMP stimulus
          positive regulation of ureteric bud formation
          nephric duct morphogenesis
          nephric duct formation
          regulation of nephron tubule epithelial cell differentiation
          interleukin-4 secretion
          interferon-gamma secretion
          lymphocyte migration
          negative regulation of DNA demethylation
          regulation of establishment of cell polarity
          negative regulation of cell motility
          negative regulation of endothelial cell apoptotic process
          positive regulation of T-helper 2 cell cytokine production
          negative regulation of cell proliferation involved in mesonephros development
          positive regulation of thyroid hormone generation
          positive regulation of histone H3-K9 acetylation
          positive regulation of interleukin-5 secretion
          positive regulation of interleukin-13 secretion
          positive regulation of transcription regulatory region DNA binding
          regulation of cellular response to X-ray
          negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation
          negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation
          transcription regulatory region sequence-specific DNA binding
          RNA polymerase II regulatory region sequence-specific DNA binding
          RNA polymerase II core promoter sequence-specific DNA binding
          core promoter proximal region sequence-specific DNA binding
          core promoter sequence-specific DNA binding
          nucleic acid binding transcription factor activity
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding
          RNA polymerase II transcription factor binding
          enhancer sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding
          DNA binding
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          transcription coactivator activity
          interleukin-2 receptor binding
          protein binding
          transcription factor binding
          zinc ion binding
          transcription regulatory region DNA binding
          protein dimerization activity
          E-box binding
          HMG box domain binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-jwmpg:80/100.66.76.145:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0