Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GATTTGCATAAGGGTAATCAGTACA[C/T]ACTTAGAGTTAACGAAAATAAATTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603930 MIM: 606958 | ||||||||||||||||||||
Literature Links: |
GPHN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GPHN - gephyrin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024218.1 | Intron | NP_001019389.1 | ||||
NM_020806.4 | Intron | NP_065857.1 | ||||
XM_005267254.3 | Intron | XP_005267311.1 | ||||
XM_011536340.2 | Intron | XP_011534642.1 | ||||
XM_011536342.2 | Intron | XP_011534644.1 | ||||
XM_011536343.2 | Intron | XP_011534645.1 | ||||
XM_011536344.2 | Intron | XP_011534646.1 | ||||
XM_011536345.2 | Intron | XP_011534647.1 | ||||
XM_011536346.2 | Intron | XP_011534648.1 | ||||
XM_011536347.2 | Intron | XP_011534649.1 | ||||
XM_017020913.1 | Intron | XP_016876402.1 | ||||
XM_017020914.1 | Intron | XP_016876403.1 | ||||
XM_017020915.1 | Intron | XP_016876404.1 | ||||
XM_017020916.1 | Intron | XP_016876405.1 | ||||
XM_017020917.1 | Intron | XP_016876406.1 | ||||
XM_017020918.1 | Intron | XP_016876407.1 | ||||
XM_017020919.1 | Intron | XP_016876408.1 | ||||
XM_017020920.1 | Intron | XP_016876409.1 | ||||
XM_017020921.1 | Intron | XP_016876410.1 | ||||
XM_017020922.1 | Intron | XP_016876411.1 | ||||
XM_017020923.1 | Intron | XP_016876412.1 | ||||
XM_017020924.1 | Intron | XP_016876413.1 | ||||
XM_017020925.1 | Intron | XP_016876414.1 | ||||
XM_017020926.1 | Intron | XP_016876415.1 |
LOC105370541 - uncharacterized LOC105370541 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MPP5 - membrane palmitoylated protein 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256550.1 | Intron | NP_001243479.1 | ||||
NM_022474.3 | Intron | NP_071919.2 | ||||
XM_005268003.1 | Intron | XP_005268060.1 | ||||
XM_011537086.2 | Intron | XP_011535388.1 | ||||
XM_011537087.2 | Intron | XP_011535389.1 |