Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__11722237_20
          See other TLR4 GT Assays ›
          SNP ID:
          rs4986791
          Gene
          TLR4
          Gene Name
          toll like receptor 4
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.9: 117713324 - 117713324 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TGTTCTCAAAGTGATTTTGGGACAA[C/T]CAGCCTAAAGTATTTAGATCTGAGC

          Assay ID C__11722237_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603030

          Literature Links:

          TLR4 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.04)
          (0.96)
          Caucasian - Not Available CEPH (CEU)
          T (0.05)
          (0.95)
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.12)
          (0.88)
          Chinese - Not Available CHB (Han Chinese)
          T (0.01)
          (0.99)
          AFR
          T (0.01)
          (0.99)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.06)
          (0.94)
          AMR
          T (0.04)
          (0.96)
          TLR4 - toll like receptor 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_003266.3 1614 Missense Mutation ACC,ATC T,I 359 NP_003257.1
          NM_138554.4 1614 Missense Mutation ACC,ATC T,I 399 NP_612564.1
          NM_138557.2 1614 Missense Mutation ACC,ATC T,I 199 NP_612567.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          activation of MAPK activity
          toll-like receptor signaling pathway
          B cell proliferation involved in immune response
          nitric oxide production involved in inflammatory response
          regulation of dendritic cell cytokine production
          MyD88-dependent toll-like receptor signaling pathway
          MyD88-independent toll-like receptor signaling pathway
          inflammatory response
          immune response
          I-kappaB kinase/NF-kappaB signaling
          I-kappaB phosphorylation
          positive regulation of platelet activation
          positive regulation of gene expression
          astrocyte development
          detection of fungus
          positive regulation of B cell proliferation
          lipopolysaccharide-mediated signaling pathway
          response to lipopolysaccharide
          detection of lipopolysaccharide
          interferon-gamma production
          negative regulation of interferon-gamma production
          negative regulation of interleukin-17 production
          negative regulation of interleukin-23 production
          negative regulation of interleukin-6 production
          negative regulation of tumor necrosis factor production
          positive regulation of chemokine production
          positive regulation of interferon-alpha production
          positive regulation of interferon-beta production
          positive regulation of interferon-gamma production
          positive regulation of interleukin-1 production
          positive regulation of interleukin-10 production
          positive regulation of interleukin-12 production
          positive regulation of interleukin-6 production
          positive regulation of interleukin-8 production
          positive regulation of tumor necrosis factor production
          negative regulation of MyD88-independent toll-like receptor signaling pathway
          toll-like receptor 4 signaling pathway
          TRIF-dependent toll-like receptor signaling pathway
          T-helper 1 type immune response
          macrophage activation
          positive regulation of NF-kappaB import into nucleus
          positive regulation of tumor necrosis factor biosynthetic process
          defense response to bacterium
          positive regulation of interleukin-12 biosynthetic process
          innate immune response
          positive regulation of MHC class II biosynthetic process
          positive regulation of interferon-beta biosynthetic process
          positive regulation of interleukin-8 biosynthetic process
          positive regulation of nitric oxide biosynthetic process
          negative regulation of osteoclast differentiation
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of JNK cascade
          interleukin-1 beta secretion
          regulation of cytokine secretion
          positive regulation of inflammatory response
          defense response to Gram-negative bacterium
          positive regulation of NF-kappaB transcription factor activity
          positive regulation of nitric-oxide synthase biosynthetic process
          intestinal epithelial structure maintenance
          positive regulation of macrophage cytokine production
          necroptotic process
          negative regulation of ERK1 and ERK2 cascade
          positive regulation of ERK1 and ERK2 cascade
          positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway
          positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway
          cellular response to lipopolysaccharide
          cellular response to lipoteichoic acid
          cellular response to mechanical stimulus
          apoptotic signaling pathway
          positive regulation of NLRP3 inflammasome complex assembly
          lipopolysaccharide binding
          lipopolysaccharide receptor activity
          receptor activity
          transmembrane signaling receptor activity
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline