Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__11786248_10
          See other RUVBL1 GT Assays ›
          SNP ID:
          rs3733158
          Gene
          RUVBL1 RUVBL1-AS1 SEC61A1
          Gene Name
          RuvB like AAA ATPase 1
          RUVBL1 antisense RNA 1
          Sec61 translocon alpha 1 subunit
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.3: 128068314 - 128068314 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GAGATGGAAGCATGTGGCCAGGCGG[A/G]TAGGAGACAGTGCAGTAAGGGTCCT

          Assay ID C__11786248_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603449 MIM: 609213

          Literature Links:

          RUVBL1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.20)
          (0.80)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.09)
          (0.91)
          African American - Not Available YRI (Yoruba)
          C (0.24)
          (0.76)
          SAS
          C (0.26)
          (0.74)
          Chinese - Not Available JPT (Japanese)
          C (0.06)
          (0.94)
          AFR
          C (0.23)
          (0.77)
          Japanese - Not Available CHB (Han Chinese)
          C (0.12)
          (0.88)
          EUR
          C (0.24)
          (0.76)
          AMR
          C (0.18)
          (0.82)
          RUVBL1 - RuvB like AAA ATPase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001319084.1 Intron NP_001306013.1
          NM_001319086.1 Intron NP_001306015.1
          NM_003707.2 Intron NP_003698.1
          XM_005247841.3 Intron XP_005247898.1
          XM_011513248.1 Intron XP_011511550.1
          XM_011513249.2 Intron XP_011511551.1
          XM_017007356.1 Intron XP_016862845.1
          XM_017007357.1 Intron XP_016862846.1
          RUVBL1-AS1 - RUVBL1 antisense RNA 1
          There are no transcripts associated with this gene.
          SEC61A1 - Sec61 translocon alpha 1 subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_013336.3 Intron NP_037468.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          box C/D snoRNP assembly
          DNA repair
          DNA recombination
          chromatin remodeling
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          mitotic nuclear division
          spermatogenesis
          DNA duplex unwinding
          CENP-A containing nucleosome assembly
          regulation of growth
          histone H4 acetylation
          histone H2A acetylation
          cell division
          cell-cell adhesion
          regulation of mitophagy
          positive regulation of protein targeting to mitochondrion
          beta-catenin-TCF complex assembly
          positive regulation of telomerase RNA localization to Cajal body
          SRP-dependent cotranslational protein targeting to membrane
          posttranslational protein targeting to membrane
          endoplasmic reticulum organization
          cell growth
          response to interferon-gamma
          IRE1-mediated unfolded protein response
          protein targeting to ER
          DNA helicase activity
          protein binding
          ATP binding
          ATPase activity
          ATP-dependent 5'-3' DNA helicase activity
          cadherin binding involved in cell-cell adhesion
          ribosome binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline