Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__12035312_10
          See other C2ORF61 GT Assays ›
          SNP ID:
          rs815802
          Gene
          C2orf61 CALM2
          Gene Name
          chromosome 2 open reading frame 61
          calmodulin 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.2: 47164910 - 47164910 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CGCGTACACCTTCCAGTTTCATTCC[A/G]TATTACCTCTTCCCTGGACTCAACT

          Assay ID C__12035312_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 114182

          Literature Links:

          C2orf61 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.10)
          (0.90)
          Caucasian - Not Available CEPH (CEU)
          C (0.10)
          (0.90)
          EAS
          C (0.11)
          (0.89)
          African American - Not Available YRI (Yoruba)
          C (0.11)
          (0.89)
          SAS
          C (0.06)
          (0.94)
          Chinese - Not Available JPT (Japanese)
          C (0.14)
          (0.86)
          AFR
          C (0.11)
          (0.89)
          Japanese - Not Available CHB (Han Chinese)
          C (0.12)
          (0.88)
          EUR
          C (0.11)
          (0.89)
          AMR
          C (0.09)
          (0.91)
          C2orf61 - chromosome 2 open reading frame 61
          There are no transcripts associated with this gene.
          CALM2 - calmodulin 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001305624.1 Intron NP_001292553.1
          NM_001305625.1 Intron NP_001292554.1
          NM_001305626.1 Intron NP_001292555.1
          NM_001743.5 Intron NP_001734.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          calmodulin-related

          Gene Ontology Categories:

          Function(s) Process(es)

          G2/M transition of mitotic cell cycle
          MAPK cascade
          response to amphetamine
          regulation of heart rate
          platelet degranulation
          detection of calcium ion
          glycogen catabolic process
          muscle contraction
          G-protein coupled receptor signaling pathway
          activation of adenylate cyclase activity
          Wnt signaling pathway, calcium modulating pathway
          positive regulation of peptidyl-threonine phosphorylation
          negative regulation of peptidyl-threonine phosphorylation
          regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum
          regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion
          substantia nigra development
          regulation of rhodopsin mediated signaling pathway
          positive regulation of cyclic nucleotide metabolic process
          positive regulation of protein autophosphorylation
          regulation of cytokinesis
          positive regulation of phosphoprotein phosphatase activity
          ion transmembrane transport
          positive regulation of protein dephosphorylation
          Fc-epsilon receptor signaling pathway
          positive regulation of DNA binding
          positive regulation of GTPase activity
          inositol phosphate metabolic process
          regulation of nitric-oxide synthase activity
          positive regulation of nitric-oxide synthase activity
          positive regulation of cyclic-nucleotide phosphodiesterase activity
          response to corticosterone
          response to calcium ion
          regulation of cardiac muscle contraction
          negative regulation of ryanodine-sensitive calcium-release channel activity
          positive regulation of ryanodine-sensitive calcium-release channel activity
          positive regulation of protein serine/threonine kinase activity
          regulation of high voltage-gated calcium channel activity
          regulation of cell communication by electrical coupling involved in cardiac conduction
          Ras guanyl-nucleotide exchange factor activity
          calcium ion binding
          protein binding
          adenylate cyclase binding
          inositol-1,4,5-trisphosphate 3-kinase activity
          ligand-gated ion channel activity
          protein kinase binding
          protein domain specific binding
          nitric-oxide synthase regulator activity
          titin binding
          type 3 metabotropic glutamate receptor binding
          thioesterase binding
          N-terminal myristoylation domain binding
          phospholipase binding
          protein serine/threonine kinase activator activity
          phosphatidylinositol 3-kinase binding
          ion channel binding
          calcium-dependent protein binding
          nitric-oxide synthase binding
          protein phosphatase activator activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline