Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Veja todas as categorias de produtos
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__12078231_10
          See other IL18 GT Assays ›
          SNP ID:
          rs5744276
          Gene
          IL18
          Gene Name
          interleukin 18
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.11: 112146148 - 112146148 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AAAGTCTGAGGGAACCCTGGCCAAG[C/G]CTGGATATAGATACATATATACATG

          Assay ID C__12078231_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600953

          Literature Links:

          IL18 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.07)
          (0.93)
          Caucasian - Not Available CEPH (CEU)
          G (0.21)
          (0.79)
          EAS
          G (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.06)
          (0.94)
          Chinese - Not Available CHB (Han Chinese)
          G (0.01)
          (0.99)
          AFR
          G (0.01)
          (0.99)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.22)
          (0.78)
          AMR
          G (0.10)
          (0.90)
          IL18 - interleukin 18
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001243211.1 Intron NP_001230140.1
          NM_001562.3 Intron NP_001553.1
          XM_011542805.1 Intron XP_011541107.1
          XM_011542806.2 Intron XP_011541108.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          cytokine interleukin superfamily intercellular signal molecule

          Gene Ontology Categories:

          Function(s) Process(es)

          MAPK cascade
          angiogenesis
          inflammatory response
          immune response
          cell-cell signaling
          positive regulation of gene expression
          natural killer cell activation
          regulation of cell adhesion
          sleep
          lipopolysaccharide-mediated signaling pathway
          positive regulation of granulocyte macrophage colony-stimulating factor production
          positive regulation of interferon-gamma production
          positive regulation of interleukin-17 production
          positive regulation of natural killer cell proliferation
          positive regulation of tissue remodeling
          chemokine biosynthetic process
          T-helper 1 type immune response
          type 2 immune response
          interleukin-2 biosynthetic process
          interferon-gamma biosynthetic process
          positive regulation of activated T cell proliferation
          interleukin-13 biosynthetic process
          granulocyte macrophage colony-stimulating factor biosynthetic process
          positive regulation of NF-kappaB import into nucleus
          positive regulation of tyrosine phosphorylation of Stat3 protein
          negative regulation of myoblast differentiation
          positive regulation of inflammatory response
          positive regulation of NK T cell proliferation
          cellular response to organic cyclic compound
          cytokine activity
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-jwmpg:80/100.66.76.145:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0