Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__15854163_70
          See other ABCG2 GT Assays ›
          SNP ID:
          rs2231142
          Gene
          ABCG2
          Gene Name
          ATP binding cassette subfamily G member 2 (Junior blood group)
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.4: 88131171 - 88131171 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          GCAAGCCGAAGAGCTGCTGAGAACT[G/T]TAAGTTTTCTCTCACCGTCAGAGTG

          Assay ID C__15854163_70
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603756

          Literature Links:

          ABCG2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.12)
          (0.88)
          Caucasian
          T (0.09)
          (0.91)
          CEPH (CEU)
          A (0.11)
          (0.89)
          EAS
          A (0.29)
          (0.71)
          African American
          T (0.06)
          (0.94)
          YRI (Yoruba)
          A (0.00)
          (1.00)
          SAS
          A (0.10)
          (0.90)
          Japanese
          T (0.33)
          (0.67)
          JPT (Japanese)
          A (0.34)
          (0.66)
          AFR
          A (0.01)
          (0.99)
          Chinese
          T (0.44)
          (0.56)
          CHB (Han Chinese)
          A (0.29)
          (0.71)
          EUR
          A (0.09)
          (0.91)
          AMR
          A (0.14)
          (0.86)
          ABCG2 - ATP binding cassette subfamily G member 2 (Junior blood group)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001257386.1 1028 Missense Mutation AAG,CAG K,Q 141 NP_001244315.1
          NM_004827.2 1028 Missense Mutation AAG,CAG K,Q 141 NP_004818.2
          XM_005263354.3 1028 Missense Mutation AAG,CAG K,Q 141 XP_005263411.1
          XM_005263355.3 1028 Missense Mutation AAG,CAG K,Q 141 XP_005263412.1
          XM_005263356.3 1028 Missense Mutation AAG,CAG K,Q 141 XP_005263413.1
          XM_011532420.2 1028 Missense Mutation AAG,CAG K,Q 141 XP_011530722.1
          XM_017008852.1 1028 Missense Mutation AAG,CAG K,Q 141 XP_016864341.1
          XM_017008853.1 1028 Missense Mutation AAG,CAG K,Q 141 XP_016864342.1

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          ATP-binding cassette (ABC) transporter primary active transporter transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          transport
          drug transmembrane transport
          cellular iron ion homeostasis
          response to iron ion
          heme transport
          response to drug
          xenobiotic transport
          urate metabolic process
          drug export
          response to folic acid
          embryonic process involved in female pregnancy
          cellular response to dexamethasone stimulus
          transporter activity
          protein binding
          ATP binding
          xenobiotic-transporting ATPase activity
          heme transporter activity
          ATPase activity, coupled to transmembrane movement of substances
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0