Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Veja todas as categorias de produtos
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__15854163_70
          See other ABCG2 GT Assays ›
          SNP ID:
          rs2231142
          Gene
          ABCG2
          Gene Name
          ATP binding cassette subfamily G member 2 (Junior blood group)
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.4: 88131171 - 88131171 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          GCAAGCCGAAGAGCTGCTGAGAACT[G/T]TAAGTTTTCTCTCACCGTCAGAGTG

          Assay ID C__15854163_70
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603756

          Literature Links:

          ABCG2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.12)
          (0.88)
          Caucasian
          T (0.09)
          (0.91)
          CEPH (CEU)
          A (0.11)
          (0.89)
          EAS
          A (0.29)
          (0.71)
          African American
          T (0.06)
          (0.94)
          YRI (Yoruba)
          A (0.00)
          (1.00)
          SAS
          A (0.10)
          (0.90)
          Japanese
          T (0.33)
          (0.67)
          JPT (Japanese)
          A (0.34)
          (0.66)
          AFR
          A (0.01)
          (0.99)
          Chinese
          T (0.44)
          (0.56)
          CHB (Han Chinese)
          A (0.29)
          (0.71)
          EUR
          A (0.09)
          (0.91)
          AMR
          A (0.14)
          (0.86)
          ABCG2 - ATP binding cassette subfamily G member 2 (Junior blood group)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001257386.1 1028 Missense Mutation AAG,CAG K,Q 141 NP_001244315.1
          NM_004827.2 1028 Missense Mutation AAG,CAG K,Q 141 NP_004818.2
          XM_005263354.3 1028 Missense Mutation AAG,CAG K,Q 141 XP_005263411.1
          XM_005263355.3 1028 Missense Mutation AAG,CAG K,Q 141 XP_005263412.1
          XM_005263356.3 1028 Missense Mutation AAG,CAG K,Q 141 XP_005263413.1
          XM_011532420.2 1028 Missense Mutation AAG,CAG K,Q 141 XP_011530722.1
          XM_017008852.1 1028 Missense Mutation AAG,CAG K,Q 141 XP_016864341.1
          XM_017008853.1 1028 Missense Mutation AAG,CAG K,Q 141 XP_016864342.1

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          ATP-binding cassette (ABC) transporter primary active transporter transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          transport
          drug transmembrane transport
          cellular iron ion homeostasis
          response to iron ion
          heme transport
          response to drug
          xenobiotic transport
          urate metabolic process
          drug export
          response to folic acid
          embryonic process involved in female pregnancy
          cellular response to dexamethasone stimulus
          transporter activity
          protein binding
          ATP binding
          xenobiotic-transporting ATPase activity
          heme transporter activity
          ATPase activity, coupled to transmembrane movement of substances
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline