Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__15932627_10
          See other C6ORF1 GT Assays ›
          SNP ID:
          rs2780220
          Gene
          C6orf1 HMGA1 MIR6835
          Gene Name
          chromosome 6 open reading frame 1
          high mobility group AT-hook 1
          microRNA 6835
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 34242484 - 34242484 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TTCCTAGGGGTCTTCTGGGCTCTTG[A/T]CATTTTGCATCTTAGAAACCTGCAG

          Assay ID C__15932627_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611419 MIM: 600701

          Literature Links:

          C6orf1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          C6orf1 - chromosome 6 open reading frame 1
          There are no transcripts associated with this gene.
          HMGA1 - high mobility group AT-hook 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001319077.1 Intron NP_001306006.1
          NM_001319078.1 Intron NP_001306007.1
          NM_001319079.1 Intron NP_001306008.1
          NM_001319080.1 Intron NP_001306009.1
          NM_001319081.1 Intron NP_001306010.1
          NM_001319082.1 Intron NP_001306011.1
          NM_002131.3 Intron NP_002122.1
          NM_145899.2 Intron NP_665906.1
          NM_145901.2 Intron NP_665908.1
          NM_145902.2 Intron NP_665909.1
          NM_145903.2 Intron NP_665910.1
          NM_145905.2 Intron NP_665912.1
          MIR6835 - microRNA 6835
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          endodeoxyribonuclease

          Gene Ontology Categories:

          Function(s) Process(es)

          DNA unwinding involved in DNA replication
          nucleosome disassembly
          regulation of transcription, DNA-templated
          transcription from RNA polymerase II promoter
          protein complex assembly
          negative regulation of cell proliferation
          response to virus
          negative regulation of chromatin silencing
          senescence-associated heterochromatin focus assembly
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          nuclear transport
          establishment of integrated proviral latency
          oncogene-induced cell senescence
          positive regulation of cellular senescence
          transcriptional activator activity, RNA polymerase II distal enhancer sequence-specific binding
          DNA binding
          AT DNA binding
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          transcription factor binding
          enzyme binding
          ligand-dependent nuclear receptor transcription coactivator activity
          retinoic acid receptor binding
          peroxisome proliferator activated receptor binding
          retinoid X receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          France flag icon
          France

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline