Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Nuevos productos
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__15966471_20
          See other LEP GT Assays ›
          SNP ID:
          rs2167270
          Gene
          LEP
          Gene Name
          leptin
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.7: 128241296 - 128241296 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GAGCCCCGTAGGAATCGCAGCGCCA[A/G]CGGTTGCAAGGTAAGGCCCCGGCGC

          Assay ID C__15966471_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 164160

          Literature Links:

          LEP PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.34)
          (0.66)
          Caucasian - Not Available CEPH (CEU)
          A (0.35)
          (0.65)
          EAS
          A (0.20)
          (0.80)
          African American - Not Available YRI (Yoruba)
          A (0.46)
          (0.54)
          SAS
          A (0.28)
          (0.72)
          Chinese - Not Available JPT (Japanese)
          A (0.19)
          (0.81)
          AFR
          A (0.44)
          (0.56)
          Japanese - Not Available CHB (Han Chinese)
          A (0.22)
          (0.78)
          EUR
          A (0.37)
          (0.63)
          AMR
          A (0.41)
          (0.59)
          LEP - leptin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000230.2 96 UTR 5 NP_000221.1
          XM_005250340.4 96 UTR 5 XP_005250397.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          peptide hormone

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          angiogenesis
          ovulation from ovarian follicle
          response to hypoxia
          positive regulation of cytokine production
          placenta development
          regulation of endothelial cell proliferation
          response to dietary excess
          cardiac muscle hypertrophy
          glucose metabolic process
          regulation of gluconeogenesis
          energy reserve metabolic process
          glycerol biosynthetic process
          lipid metabolic process
          fatty acid beta-oxidation
          tyrosine phosphorylation of STAT protein
          female pregnancy
          circadian rhythm
          cholesterol metabolic process
          bile acid metabolic process
          regulation of blood pressure
          adult feeding behavior
          negative regulation of autophagy
          negative regulation of lipid storage
          positive regulation of phosphatidylinositol 3-kinase signaling
          response to activity
          sexual reproduction
          central nervous system neuron development
          insulin secretion
          T cell differentiation
          regulation of intestinal cholesterol absorption
          positive regulation of TOR signaling
          negative regulation of appetite
          prostaglandin secretion
          response to estradiol
          regulation of natural killer cell activation
          regulation of natural killer cell proliferation
          response to insulin
          response to vitamin E
          leptin-mediated signaling pathway
          positive regulation of luteinizing hormone secretion
          positive regulation of peroxisome proliferator activated receptor signaling pathway
          bone mineralization involved in bone maturation
          negative regulation of appetite by leptin-mediated signaling pathway
          positive regulation of T cell proliferation
          regulation of natural killer cell mediated cytotoxicity
          hormone metabolic process
          positive regulation of tyrosine phosphorylation of Stat3 protein
          glucose homeostasis
          eating behavior
          negative regulation of apoptotic process
          positive regulation of ion transport
          positive regulation of MAPK cascade
          cellular response to leptin stimulus
          response to ethanol
          positive regulation of myeloid cell differentiation
          regulation of angiogenesis
          negative regulation of vasoconstriction
          negative regulation of glucose import
          positive regulation of JAK-STAT cascade
          positive regulation of insulin receptor signaling pathway
          regulation of bone remodeling
          positive regulation of follicle-stimulating hormone secretion
          positive regulation of developmental growth
          regulation of insulin secretion
          regulation of steroid biosynthetic process
          intestinal absorption
          leukocyte tethering or rolling
          regulation of nitric-oxide synthase activity
          regulation of cell cycle
          positive regulation of protein kinase B signaling
          regulation of lipoprotein lipid oxidation
          adipose tissue development
          negative regulation of cartilage development
          negative regulation of glucagon secretion
          cellular response to L-ascorbic acid
          cellular response to retinoic acid
          interleukin-6 secretion
          interleukin-8 secretion
          regulation of brown fat cell differentiation
          bone growth
          regulation of cytokine production involved in inflammatory response
          positive regulation of p38MAPK cascade
          positive regulation of fat cell apoptotic process
          activation of protein kinase C activity
          positive regulation of STAT protein import into nucleus
          positive regulation of reactive oxygen species metabolic process
          negative regulation of glutamine transport
          positive regulation of hepatic stellate cell activation
          hormone activity
          growth factor activity
          peptide hormone receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Aviso de privacidad
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-7fb9f846c9-xq5gc:80/100.66.76.64:80.
          git-commit: 8207b5afa5c305bd40e0a4f0b9b53fd46f2a8829
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.59.1-2026.09.91-1.0