Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GCAAGTGTTCATAATTAACAAAAGA[A/C]ATCTAAAAAAAGAGATGATGTGTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607160 MIM: 609344 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP6V1F PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATP6V1F - ATPase H+ transporting V1 subunit F | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCP - kielin/chordin-like protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135914.1 | 3292 | Intron | NP_001129386.1 | |||
NM_199349.2 | 3292 | Intron | NP_955381.2 | |||
XM_017012184.1 | 3292 | Intron | XP_016867673.1 | |||
XM_017012185.1 | 3292 | Intron | XP_016867674.1 | |||
XM_017012186.1 | 3292 | Intron | XP_016867675.1 | |||
XM_017012187.1 | 3292 | Intron | XP_016867676.1 | |||
XM_017012188.1 | 3292 | Intron | XP_016867677.1 | |||
XM_017012189.1 | 3292 | Intron | XP_016867678.1 | |||
XM_017012190.1 | 3292 | Intron | XP_016867679.1 | |||
XM_017012191.1 | 3292 | Intron | XP_016867680.1 | |||
XM_017012192.1 | 3292 | Intron | XP_016867681.1 | |||
XM_017012193.1 | 3292 | Intron | XP_016867682.1 | |||
XM_017012194.1 | 3292 | Intron | XP_016867683.1 |
LOC100130705 - uncharacterized LOC100130705 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001195150.1 | 3292 | UTR 3 | NP_001182079.1 |