Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__16021387_20
          See other AP4B1-AS1 GT Assays ›
          SNP ID:
          rs2476601
          Gene
          AP4B1-AS1 PTPN22
          Gene Name
          AP4B1 antisense RNA 1
          protein tyrosine phosphatase, non-receptor type 22
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.1: 113834946 - 113834946 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ACCACAATAAATGATTCAGGTGTCC[A/G]TACAGGAAGTGGAGGGGGGATTTCA

          Assay ID C__16021387_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          98 submissions

          Phenotype:

          MIM: 600716

          Literature Links:

          AP4B1-AS1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.03)
          (0.97)
          Caucasian - Not Available CEPH (CEU)
          A (0.12)
          (0.88)
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          A (0.01)
          (0.99)
          SAS
          A (0.01)
          (0.99)
          Chinese - Not Available JPT (Japanese)
          A (0.02)
          (0.98)
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available CHB (Han Chinese)
          A (0.02)
          (0.98)
          EUR
          A (0.09)
          (0.91)
          AMR
          A (0.04)
          (0.96)
          AP4B1-AS1 - AP4B1 antisense RNA 1
          There are no transcripts associated with this gene.
          PTPN22 - protein tyrosine phosphatase, non-receptor type 22
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001193431.2 1994 Missense Mutation CGG,TGG R,W 620 NP_001180360.1
          NM_001308297.1 1994 Missense Mutation CGG,TGG R,W 596 NP_001295226.1
          NM_012411.5 1994 Missense Mutation CGG,TGG R,W 565 NP_036543.4
          NM_015967.6 1994 Missense Mutation CGG,TGG R,W 620 NP_057051.3
          XM_011541221.1 1994 Missense Mutation CGG,TGG R,W 594 XP_011539523.1
          XM_011541222.1 1994 Missense Mutation CGG,TGG R,W 620 XP_011539524.1
          XM_011541223.2 1994 Missense Mutation CGG,TGG R,W 620 XP_011539525.1
          XM_011541225.2 1994 Missense Mutation CGG,TGG R,W 596 XP_011539527.1
          XM_017001004.1 1994 Missense Mutation CGG,TGG R,W 620 XP_016856493.1
          XM_017001005.1 1994 Missense Mutation CGG,TGG R,W 505 XP_016856494.1
          XM_017001006.1 1994 Intron XP_016856495.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          protein dephosphorylation
          autophagy
          negative regulation of autophagy
          positive regulation of gene expression
          negative regulation of gene expression
          T cell differentiation
          lipopolysaccharide-mediated signaling pathway
          positive regulation of type I interferon production
          response to lipopolysaccharide
          negative regulation of tumor necrosis factor production
          regulation of natural killer cell proliferation
          positive regulation of toll-like receptor 3 signaling pathway
          positive regulation of toll-like receptor 4 signaling pathway
          peptidyl-tyrosine dephosphorylation
          phosphoanandamide dephosphorylation
          negative regulation of JUN kinase activity
          regulation of innate immune response
          regulation of B cell receptor signaling pathway
          negative regulation of T cell receptor signaling pathway
          negative regulation of T cell activation
          positive regulation of ERK1 and ERK2 cascade
          negative regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway
          cellular response to muramyl dipeptide
          negative regulation of interleukin-6 secretion
          regulation of NIK/NF-kappaB signaling
          positive regulation of protein K63-linked ubiquitination
          positive regulation of interferon-gamma secretion
          negative regulation of p38MAPK cascade
          negative regulation of interleukin-8 secretion
          protein tyrosine phosphatase activity
          protein binding
          phosphatase activity
          SH3 domain binding
          kinase binding
          ubiquitin protein ligase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline