Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__16026001_20
          See other CYP2E1 GT Assays ›
          SNP ID:
          rs2070676
          Gene
          CYP2E1
          Gene Name
          cytochrome P450 family 2 subfamily E member 1
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.10: 133537633 - 133537633 on Build GRCh38
          Polymorphism:
          G/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          CCTTCACTAAGCAACTCCTTCAACT[G/C]GAAATATACTATCCTATATAGCATA

          Assay ID C__16026001_20
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 124040

          Literature Links:

          CYP2E1 PubMed Links

          Allele Nomenclature:

          CYP2E1*1B,g.9896C>G

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.31)
          (0.69)
          Caucasian
          G (0.09)
          (0.91)
          CEPH (CEU)
          C (0.13)
          (0.87)
          EAS
          G (0.21)
          (0.79)
          African American
          C (0.41)
          (0.59)
          YRI (Yoruba)
          C (0.32)
          (0.68)
          SAS
          G (0.17)
          (0.83)
          Japanese
          G (0.16)
          (0.84)
          JPT (Japanese)
          C (0.17)
          (0.83)
          AFR
          G (0.31)
          (0.69)
          Chinese
          G (0.18)
          (0.82)
          CHB (Han Chinese)
          G (0.16)
          (0.84)
          EUR
          C (0.13)
          (0.87)
          AMR
          G (0.18)
          (0.82)
          CYP2E1 - cytochrome P450 family 2 subfamily E member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000773.3 Intron NP_000764.1

          Back To Top

          More Information


          Additional Information:

          The CYP2E1 gene exhibits copy number variation. Individuals may carry extra copies of CYP2E1. CYP2E1 SNP genotyping assays run on samples having 2 or more gene copies that are homozygous for the SNP allele will cluster together, and samples having more than 2 gene copies that are heterozygous may run between the 2 copy heterozygous and homozygous clusters. For accurate CYP2E1 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          oxidoreductase oxygenase metabolite interconversion enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          triglyceride metabolic process
          xenobiotic metabolic process
          steroid metabolic process
          response to ozone
          response to organonitrogen compound
          monoterpenoid metabolic process
          drug metabolic process
          carbon tetrachloride metabolic process
          benzene metabolic process
          epoxygenase P450 pathway
          halogenated hydrocarbon metabolic process
          response to drug
          response to ethanol
          heterocycle metabolic process
          oxidation-reduction process
          monooxygenase activity
          iron ion binding
          arachidonic acid epoxygenase activity
          steroid hydroxylase activity
          oxidoreductase activity
          oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen
          oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
          oxygen binding
          enzyme binding
          heme binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline