Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__16037059_10
          See other RAD51 GT Assays ›
          SNP ID:
          rs2619679
          Gene
          RAD51 RAD51-AS1
          Gene Name
          RAD51 recombinase
          RAD51 antisense RNA 1 (head to head)
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.15: 40694039 - 40694039 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TAATGTCTTCCACTTCGCCCAAGAA[A/T]CCCTACTCAGCTAGCTTGTGGTGTT

          Assay ID C__16037059_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 179617

          Literature Links:

          RAD51 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.44)
          (0.56)
          Caucasian - Not Available CEPH (CEU)
          T (0.47)
          (0.53)
          EAS
          A (0.24)
          (0.76)
          African American - Not Available YRI (Yoruba)
          T (0.33)
          (0.67)
          SAS
          A (0.36)
          (0.64)
          Chinese - Not Available JPT (Japanese)
          A (0.20)
          (0.80)
          AFR
          T (0.34)
          (0.66)
          Japanese - Not Available CHB (Han Chinese)
          A (0.17)
          (0.83)
          EUR
          A (0.50)
          (0.50)
          AMR
          A (0.37)
          (0.63)
          RAD51 - RAD51 recombinase
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001164269.1 Intron NP_001157741.1
          NM_001164270.1 Intron NP_001157742.1
          NM_002875.4 Intron NP_002866.2
          NM_133487.3 Intron NP_597994.3
          XM_006720626.3 Intron XP_006720689.1
          XM_011521857.2 Intron XP_011520159.1
          XM_011521858.2 Intron XP_011520160.1
          XM_011521859.2 Intron XP_011520161.1
          XM_011521860.2 Intron XP_011520162.1
          XM_011521861.2 Intron XP_011520163.1
          XM_011521862.2 Intron XP_011520164.1
          RAD51-AS1 - RAD51 antisense RNA 1 (head to head)
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          DNA metabolism protein

          Gene Ontology Categories:

          Function(s) Process(es)

          telomere maintenance via recombination
          double-strand break repair via homologous recombination
          DNA recombinase assembly
          DNA synthesis involved in DNA repair
          strand displacement
          regulation of protein phosphorylation
          DNA unwinding involved in DNA replication
          DNA repair
          DNA recombination
          mitotic recombination
          cellular response to DNA damage stimulus
          meiotic nuclear division
          reciprocal meiotic recombination
          response to toxic substance
          response to X-ray
          regulation of double-strand break repair via homologous recombination
          telomere maintenance via telomere lengthening
          replication fork processing
          strand invasion
          response to drug
          positive regulation of DNA ligation
          protein homooligomerization
          chromosome organization involved in meiotic cell cycle
          cellular response to ionizing radiation
          cellular response to gamma radiation
          cellular response to hydroxyurea
          cellular response to cisplatin
          cellular response to camptothecin
          response to etoposide
          replication-born double-strand break repair via sister chromatid exchange
          mitotic recombination-dependent replication fork processing
          recombinase activity
          four-way junction DNA binding
          chromatin binding
          double-stranded DNA binding
          single-stranded DNA binding
          endodeoxyribonuclease activity
          protein binding
          ATP binding
          protein C-terminus binding
          identical protein binding
          single-stranded DNA-dependent ATPase activity
          DNA polymerase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-t4kr2:80/100.66.77.141:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0