Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__25651059_10
          See other PSMB8 GT Assays ›
          SNP ID:
          rs17220241
          Gene
          PSMB8 PSMB8-AS1 PSMB9 TAP1
          Gene Name
          proteasome subunit beta 8
          PSMB8 antisense RNA 1 (head to head)
          proteasome subunit beta 9
          transporter 1, ATP binding cassette subfamily B member
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 32854467 - 32854467 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          ATAGAGTATTTCTTTTCTGAGGGGG[G/T]TCGTCTAGAGTGTCCGTGAAGGGAA

          Assay ID C__25651059_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 177046 MIM: 177045 MIM: 170260

          Literature Links:

          PSMB8 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.04)
          (0.96)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.12)
          (0.88)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.03)
          (0.97)
          AMR
          T (0.05)
          (0.95)
          PSMB8 - proteasome subunit beta 8
          There are no transcripts associated with this gene.
          PSMB8-AS1 - PSMB8 antisense RNA 1 (head to head)
          There are no transcripts associated with this gene.
          PSMB9 - proteasome subunit beta 9
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_002800.4 Intron NP_002791.1
          TAP1 - transporter 1, ATP binding cassette subfamily B member
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000593.5 Intron NP_000584.2
          NM_001292022.1 Intron NP_001278951.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          protease ATP-binding cassette (ABC) transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          MAPK cascade
          protein polyubiquitination
          liver development
          stimulatory C-type lectin receptor signaling pathway
          antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent
          regulation of cellular amino acid metabolic process
          muscle atrophy
          anaphase-promoting complex-dependent catabolic process
          tumor necrosis factor-mediated signaling pathway
          NIK/NF-kappaB signaling
          Fc-epsilon receptor signaling pathway
          response to drug
          proteasome-mediated ubiquitin-dependent protein catabolic process
          response to alkaloid
          regulation of mRNA stability
          spleen development
          thymus development
          T cell receptor signaling pathway
          negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle
          positive regulation of ubiquitin-protein ligase activity involved in regulation of mitotic cell cycle transition
          Wnt signaling pathway, planar cell polarity pathway
          cellular response to electrical stimulus
          cellular response to interleukin-1
          negative regulation of canonical Wnt signaling pathway
          positive regulation of canonical Wnt signaling pathway
          cellular response to virus
          response to benzene
          regulation of cysteine-type endopeptidase activity
          adaptive immune response
          antigen processing and presentation of peptide antigen via MHC class I
          antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent
          antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent
          antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent
          positive regulation of antigen processing and presentation of peptide antigen via MHC class I
          defense response
          peptide transport
          intracellular transport of viral protein in host cell
          antigen processing and presentation of endogenous peptide antigen via MHC class I
          protection from natural killer cell mediated cytotoxicity
          cytosol to ER transport
          transmembrane transport
          threonine-type endopeptidase activity
          protein binding
          proteasome binding
          ATP binding
          peptide transporter activity
          peptide-transporting ATPase activity
          MHC class Ib protein binding
          MHC class I protein binding
          peptide antigen binding
          ATPase activity, coupled to transmembrane movement of substances
          protein homodimerization activity
          ADP binding
          TAP1 binding
          TAP2 binding
          tapasin binding
          protein heterodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline