Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CAAACGCCGAGTTCGACCCCGACCT[A/G]CCAGGGGGCGGTCTGCACCGCTGTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603272 MIM: 616698 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CNKSR1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CNKSR1 - connector enhancer of kinase suppressor of Ras 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM110D - family with sequence similarity 110 member D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF593 - zinc finger protein 593 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015871.4 | 252 | Silent Mutation | CTA,CTG | L,L 55 | NP_056955.2 | |
XM_017001398.1 | 252 | Silent Mutation | CTA,CTG | L,L 55 | XP_016856887.1 |