Search
LOADING 
- SNP ID:
- rs372730053
- Gene
-
CFAP70DNAJC9-AS1 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.10: 73278382 - 73278382 on Build GRCh38
- Polymorphism:
- A/G, Transition substitution
- Context Sequence [VIC/FAM]:
ATGAAAAATAAAACTTCTTACATTG[A/G]GTGTTTAAAGGTTATTGTAAGAGAT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
CFAP70 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| CFAP70 - cilia and flagella associated protein 70 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_145170.3 | Intron | NP_660153.3 | ||||
| XM_005269489.2 | Intron | XP_005269546.1 | ||||
| XM_006717604.2 | Intron | XP_006717667.1 | ||||
| XM_006717605.2 | Intron | XP_006717668.1 | ||||
| XM_006717609.2 | Intron | XP_006717672.1 | ||||
| XM_006717610.2 | Intron | XP_006717673.1 | ||||
| XM_006717611.3 | Intron | XP_006717674.1 | ||||
| XM_011539212.2 | Intron | XP_011537514.1 | ||||
| XM_017015620.1 | Intron | XP_016871109.1 | ||||
| XM_017015621.1 | Intron | XP_016871110.1 | ||||
| XM_017015622.1 | Intron | XP_016871111.1 | ||||
| XM_017015623.1 | Intron | XP_016871112.1 | ||||
| XM_017015624.1 | Intron | XP_016871113.1 | ||||
| XM_017015625.1 | Intron | XP_016871114.1 | ||||
| XM_017015626.1 | Intron | XP_016871115.1 | ||||
| XM_017015627.1 | Intron | XP_016871116.1 | ||||
| XM_017015628.1 | Intron | XP_016871117.1 | ||||
| XM_017015629.1 | Intron | XP_016871118.1 | ||||
| XM_017015630.1 | Intron | XP_016871119.1 | ||||
| XM_017015631.1 | Intron | XP_016871120.1 | ||||
| XM_017015632.1 | Intron | XP_016871121.1 | ||||
| XM_017015633.1 | Intron | XP_016871122.1 | ||||
| DNAJC9-AS1 - DNAJC9 antisense RNA 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top