Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__25939050_20
          See other PRMT7 GT Assays ›
          SNP ID:
          rs8063446
          Gene
          PRMT7 SLC7A6 SLC7A6OS
          Gene Name
          protein arginine methyltransferase 7
          solute carrier family 7 member 6
          solute carrier family 7 member 6 opposite strand
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.16: 68310460 - 68310460 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          GTGTACTCGGACTCCTGGCCGCTCG[A/C]GGTGGTCCCCAAGGATCGGCGGCTG

          Assay ID C__25939050_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610087 MIM: 605641

          Literature Links:

          PRMT7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.11)
          (0.89)
          Caucasian - Not Available CEPH (CEU)
          C (0.09)
          (0.91)
          EAS
          C (0.06)
          (0.94)
          African American - Not Available YRI (Yoruba)
          C (0.13)
          (0.87)
          SAS
          C (0.12)
          (0.88)
          Chinese - Not Available JPT (Japanese)
          C (0.06)
          (0.94)
          AFR
          C (0.16)
          (0.84)
          Japanese - Not Available CHB (Han Chinese)
          C (0.01)
          (0.99)
          EUR
          C (0.13)
          (0.87)
          AMR
          C (0.08)
          (0.92)
          PRMT7 - protein arginine methyltransferase 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001184824.1 385 Intron NP_001171753.1
          NM_001290018.1 385 Intron NP_001276947.1
          NM_019023.2 385 Intron NP_061896.1
          XM_011523112.2 385 Intron XP_011521414.1
          XM_011523113.2 385 Intron XP_011521415.1
          XM_011523115.2 385 Intron XP_011521417.1
          XM_011523116.2 385 Intron XP_011521418.1
          XM_011523121.2 385 Intron XP_011521423.1
          XM_011523124.2 385 Intron XP_011521426.1
          XM_011523125.2 385 Intron XP_011521427.1
          XM_011523126.2 385 Intron XP_011521428.1
          XM_011523128.2 385 Intron XP_011521430.1
          XM_011523131.2 385 Intron XP_011521433.1
          XM_017023290.1 385 Intron XP_016878779.1
          XM_017023291.1 385 Intron XP_016878780.1
          XM_017023292.1 385 Intron XP_016878781.1
          XM_017023293.1 385 Intron XP_016878782.1
          XM_017023294.1 385 Intron XP_016878783.1
          XM_017023295.1 385 Intron XP_016878784.1
          XM_017023296.1 385 Intron XP_016878785.1
          XM_017023297.1 385 Intron XP_016878786.1
          XM_017023298.1 385 Intron XP_016878787.1
          XM_017023299.1 385 Intron XP_016878788.1
          XM_017023300.1 385 Intron XP_016878789.1
          XM_017023301.1 385 Intron XP_016878790.1
          XM_017023302.1 385 Intron XP_016878791.1
          XM_017023303.1 385 Intron XP_016878792.1
          XM_017023304.1 385 Intron XP_016878793.1
          XM_017023305.1 385 Intron XP_016878794.1
          XM_017023306.1 385 Intron XP_016878795.1
          XM_017023307.1 385 Intron XP_016878796.1
          XM_017023308.1 385 Intron XP_016878797.1
          XM_017023309.1 385 Intron XP_016878798.1
          XM_017023310.1 385 Intron XP_016878799.1
          XM_017023311.1 385 Intron XP_016878800.1
          XM_017023312.1 385 Intron XP_016878801.1
          XM_017023313.1 385 Intron XP_016878802.1
          XM_017023314.1 385 Intron XP_016878803.1
          XM_017023315.1 385 Intron XP_016878804.1
          XM_017023316.1 385 Intron XP_016878805.1
          SLC7A6 - solute carrier family 7 member 6
          There are no transcripts associated with this gene.
          SLC7A6OS - solute carrier family 7 member 6 opposite strand
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_032178.2 385 Missense Mutation GCG,TCG A,S 116 NP_115554.2
          XM_011523372.2 385 Missense Mutation GCG,TCG A,S 116 XP_011521674.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          spliceosomal snRNP assembly
          regulation of gene expression by genetic imprinting
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          histone methylation
          peptidyl-arginine methylation
          peptidyl-arginine methylation, to symmetrical-dimethyl arginine
          peptidyl-arginine methylation, to asymmetrical-dimethyl arginine
          cell differentiation
          histone arginine methylation
          DNA methylation involved in gamete generation
          regulation of protein binding
          histone H4-R3 methylation
          hematopoietic progenitor cell differentiation
          protein transport
          histone-arginine N-methyltransferase activity
          S-adenosylmethionine-dependent methyltransferase activity
          protein-arginine N-methyltransferase activity
          [myelin basic protein]-arginine N-methyltransferase activity
          protein-arginine omega-N monomethyltransferase activity
          protein-arginine omega-N asymmetric methyltransferase activity
          protein-arginine omega-N symmetric methyltransferase activity
          histone binding
          ribonucleoprotein complex binding
          histone methyltransferase activity (H4-R3 specific)

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline