Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GGCAAACTGTATCCCCAGCCACCTC[A/G]GGCACCTGTTGTCAGGACCTCCTGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 102600 MIM: 605525 MIM: 612222 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
APRT PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
APRT - adenine phosphoribosyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CDT1 - chromatin licensing and DNA replication factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GALNS - galactosamine (N-acetyl)-6-sulfatase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000512.4 | 1905 | UTR 3 | NP_000503.1 | |||
NM_001323543.1 | 1905 | UTR 3 | NP_001310472.1 | |||
NM_001323544.1 | 1905 | UTR 3 | NP_001310473.1 | |||
XM_005256301.3 | 1905 | UTR 3 | XP_005256358.1 | |||
XM_011522982.2 | 1905 | UTR 3 | XP_011521284.1 | |||
XM_017023111.1 | 1905 | Intron | XP_016878600.1 | |||
XM_017023112.1 | 1905 | UTR 3 | XP_016878601.1 | |||
XM_017023113.1 | 1905 | UTR 3 | XP_016878602.1 |
LOC107987238 - proline-rich proteoglycan 2-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |