Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__26201809_30
          See other CYP3A5 GT Assays ›
          SNP ID:
          rs776746
          Gene
          CYP3A5 ZSCAN25
          Gene Name
          cytochrome P450 family 3 subfamily A member 5
          zinc finger and SCAN domain containing 25
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.7: 99672916 - 99672916 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          ATGTGGTCCAAACAGGGAAGAGATA[T/C]TGAAAGACAAAAGAGCTCTTTAAAG

          Assay ID C__26201809_30
          Size VIC-FAM | 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605325

          Literature Links:

          CYP3A5 PubMed Links

          Allele Nomenclature:

          CYP3A5*10,g.6986A>G CYP3A5*11,g.6986A>G CYP3A5*3A,g.6986A>G CYP3A5*3B,g.6986A>G CYP3A5*3C,g.6986A>G CYP3A5*3D,g.6986A>G CYP3A5*3E,g.6986A>G CYP3A5*3F,g.6986A>G CYP3A5*3G,g.6986A>G CYP3A5*3H,g.6986A>G CYP3A5*3I,g.6986A>G CYP3A5*3J,g.6986A>G

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.38)
          (0.62)
          Caucasian
          T (0.01)
          (0.99)
          CEPH (CEU)
          A (0.04)
          (0.96)
          EAS
          A (0.29)
          (0.71)
          African American
          C (0.31)
          (0.69)
          YRI (Yoruba)
          G (0.16)
          (0.84)
          SAS
          A (0.33)
          (0.67)
          Japanese
          T (0.26)
          (0.74)
          JPT (Japanese)
          A (0.27)
          (0.73)
          AFR
          G (0.18)
          (0.82)
          Chinese
          T (0.37)
          (0.63)
          CHB (Han Chinese)
          A (0.33)
          (0.67)
          EUR
          A (0.06)
          (0.94)
          AMR
          A (0.20)
          (0.80)
          CYP3A5 - cytochrome P450 family 3 subfamily A member 5
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000777.4 333 Intron NP_000768.1
          NM_001190484.2 333 Intron NP_001177413.1
          NM_001291829.1 333 Intron NP_001278758.1
          NM_001291830.1 333 Intron NP_001278759.1
          XM_006715859.2 333 Intron XP_006715922.1
          XM_011515843.1 333 UTR 5 XP_011514145.1
          XM_017011781.1 333 Intron XP_016867270.1
          XM_017011782.1 333 Intron XP_016867271.1
          ZSCAN25 - zinc finger and SCAN domain containing 25
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_145115.2 333 Intron NP_660090.2
          XM_005250194.2 333 Intron XP_005250251.1
          XM_011515905.2 333 Intron XP_011514207.1
          XM_011515906.2 333 Intron XP_011514208.1
          XM_011515907.2 333 Intron XP_011514209.1
          XM_011515908.2 333 Intron XP_011514210.1
          XM_011515909.2 333 Intron XP_011514211.1
          XM_011515910.2 333 Intron XP_011514212.1
          XM_017011824.1 333 Intron XP_016867313.1
          XM_017011825.1 333 Intron XP_016867314.1
          XM_017011826.1 333 Intron XP_016867315.1
          XM_017011827.1 333 Intron XP_016867316.1

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          oxygenase C2H2 zinc finger transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          xenobiotic metabolic process
          steroid metabolic process
          alkaloid catabolic process
          drug catabolic process
          oxidative demethylation
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          monooxygenase activity
          iron ion binding
          oxidoreductase activity
          oxygen binding
          heme binding
          aromatase activity
          transcription factor activity, sequence-specific DNA binding
          sequence-specific DNA binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline