Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__26220465_10
          See other CCDC125 GT Assays ›
          SNP ID:
          rs10940210
          Gene
          CCDC125 CDK7
          Gene Name
          coiled-coil domain containing 125
          cyclin dependent kinase 7
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.5: 69273489 - 69273489 on Build GRCh38
          Polymorphism:
          C/T, Transition Substitution
          Context Sequence [VIC/FAM]:

          AATCCAGGTATGCATGCTGATCATT[C/T]TCACATTGAGAACATGGTAATGGGG

          Assay ID C__26220465_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 613781 MIM: 601955

          Literature Links:

          CCDC125 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.37)
          (0.63)
          Caucasian - Not Available CEPH (CEU)
          C (0.38)
          (0.62)
          EAS
          C (0.50)
          (0.50)
          African American - Not Available YRI (Yoruba)
          C (0.18)
          (0.82)
          SAS
          C (0.34)
          (0.66)
          Chinese - Not Available JPT (Japanese)
          C (0.32)
          (0.68)
          AFR
          C (0.23)
          (0.77)
          Japanese - Not Available CHB (Han Chinese)
          T (0.42)
          (0.58)
          EUR
          C (0.46)
          (0.54)
          AMR
          C (0.36)
          (0.64)
          CCDC125 - coiled-coil domain containing 125
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001297696.1 Intron NP_001284625.1
          NM_001297697.1 Intron NP_001284626.1
          NM_176816.4 Intron NP_789786.2
          XM_005248458.4 Intron XP_005248515.1
          XM_005248459.4 Intron XP_005248516.1
          XM_005248461.3 Intron XP_005248518.1
          XM_005248463.3 Intron XP_005248520.1
          XM_005248464.3 Intron XP_005248521.1
          XM_006714569.3 Intron XP_006714632.1
          XM_006714570.3 Intron XP_006714633.1
          XM_011543255.2 Intron XP_011541557.1
          XM_011543256.2 Intron XP_011541558.1
          XM_011543257.2 Intron XP_011541559.1
          XM_011543258.2 Intron XP_011541560.1
          XM_011543259.2 Intron XP_011541561.1
          XM_011543260.2 Intron XP_011541562.1
          XM_017009206.1 Intron XP_016864695.1
          XM_017009207.1 Intron XP_016864696.1
          XM_017009208.1 Intron XP_016864697.1
          XM_017009209.1 Intron XP_016864698.1
          XM_017009210.1 Intron XP_016864699.1
          XM_017009211.1 Intron XP_016864700.1
          CDK7 - cyclin dependent kinase 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001324069.1 Intron NP_001310998.1
          NM_001324070.1 Intron NP_001310999.1
          NM_001324071.1 Intron NP_001311000.1
          NM_001324072.1 Intron NP_001311001.1
          NM_001324074.1 Intron NP_001311003.1
          NM_001324075.1 Intron NP_001311004.1
          NM_001324077.1 Intron NP_001311006.1
          NM_001324078.1 Intron NP_001311007.1
          NM_001799.3 Intron NP_001790.1
          XM_011543094.2 Intron XP_011541396.1

          Back To Top

          More Information


          Additional Information:

          For this assay, SNP(s) [rs112988930] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          kinase non-receptor serine/threonine protein kinase non-receptor tyrosine protein kinase protein kinase transferase

          Gene Ontology Categories:

          Function(s) Process(es)

          regulation of cyclin-dependent protein serine/threonine kinase activity
          G1/S transition of mitotic cell cycle
          G2/M transition of mitotic cell cycle
          transcription-coupled nucleotide-excision repair
          nucleotide-excision repair, preincision complex assembly
          transcription initiation from RNA polymerase I promoter
          transcription elongation from RNA polymerase I promoter
          termination of RNA polymerase I transcription
          transcription from RNA polymerase II promoter
          transcription initiation from RNA polymerase II promoter
          transcription elongation from RNA polymerase II promoter
          7-methylguanosine mRNA capping
          protein phosphorylation
          cell cycle arrest
          cell proliferation
          androgen receptor signaling pathway
          snRNA transcription from RNA polymerase II promoter
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          cell division
          transcription coactivator activity
          protein kinase activity
          protein serine/threonine kinase activity
          cyclin-dependent protein serine/threonine kinase activity
          protein binding
          ATP binding
          protein C-terminus binding
          DNA-dependent ATPase activity
          RNA polymerase II carboxy-terminal domain kinase activity
          kinase activity
          androgen receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline