Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__26698600_10
          See other CEBPA GT Assays ›
          SNP ID:
          rs12691
          Gene
          CEBPA CEBPA-AS1
          Gene Name
          CCAAT/enhancer binding protein alpha
          CEBPA antisense RNA 1 (head to head)
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.19: 33300221 - 33300221 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AGTAATCCCAAAACCAAAAGGAAAG[A/G]GAGTCTCAGACCCTTCCCCCAGCTG

          Assay ID C__26698600_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 116897

          Literature Links:

          CEBPA PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.13)
          (0.87)
          Caucasian - Not Available CEPH (CEU)
          T (0.19)
          (0.81)
          EAS
          T (0.01)
          (0.99)
          African American - Not Available YRI (Yoruba)
          T (0.33)
          (0.67)
          SAS
          T (0.06)
          (0.94)
          Chinese - Not Available JPT (Japanese)
          T (0.02)
          (0.98)
          AFR
          T (0.27)
          (0.73)
          Japanese - Not Available CHB (Han Chinese)
          T (0.01)
          (0.99)
          EUR
          T (0.16)
          (0.84)
          AMR
          T (0.12)
          (0.88)
          CEBPA - CCAAT/enhancer binding protein alpha
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001285829.1 2344 UTR 3 NP_001272758.1
          NM_001287424.1 2344 UTR 3 NP_001274353.1
          NM_001287435.1 2344 UTR 3 NP_001274364.1
          NM_004364.4 2344 UTR 3 NP_004355.2
          CEBPA-AS1 - CEBPA antisense RNA 1 (head to head)
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          basic leucine zipper transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          urea cycle
          negative regulation of transcription from RNA polymerase II promoter
          liver development
          embryonic placenta development
          generation of precursor metabolites and energy
          transcription, DNA-templated
          transcription from RNA polymerase II promoter
          mitochondrion organization
          Notch signaling pathway
          cholesterol metabolic process
          negative regulation of cell proliferation
          viral process
          cytokine-mediated signaling pathway
          myeloid cell differentiation
          macrophage differentiation
          lung development
          granulocyte differentiation
          positive regulation of proteasomal ubiquitin-dependent protein catabolic process
          glucose homeostasis
          fat cell differentiation
          positive regulation of fat cell differentiation
          positive regulation of osteoblast differentiation
          negative regulation of cyclin-dependent protein serine/threonine kinase activity
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of transcription from RNA polymerase III promoter
          cell maturation
          inner ear development
          white fat cell differentiation
          brown fat cell differentiation
          lipid homeostasis
          cellular response to lithium ion
          cellular response to organic cyclic compound
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding
          DNA binding
          transcription factor activity, sequence-specific DNA binding
          transcription factor activity, RNA polymerase II distal enhancer sequence-specific binding
          transcription coactivator activity
          protein binding
          transcription factor binding
          kinase binding
          protein homodimerization activity
          transcription regulatory region DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline