Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__27830421_10
          See other GALNT7 GT Assays ›
          SNP ID:
          rs73005353
          Gene
          GALNT7 HMGB2 LOC105377538
          Gene Name
          polypeptide N-acetylgalactosaminyltransferase 7
          high mobility group box 2
          uncharacterized LOC105377538
          Set Membership:
          -
          Chromosome Location:
          Chr.4: 173332027 - 173332027 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          ACTTGAATTCACATTCTTAGCAAAA[C/T]AATTGCCTGAGCACACACACACATT

          Assay ID C__27830421_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605005 MIM: 163906

          Literature Links:

          GALNT7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.10)
          (0.90)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.10)
          (0.90)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.07)
          (0.93)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.21)
          (0.79)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.02)
          (0.98)
          AMR
          C (0.02)
          (0.98)
          GALNT7 - polypeptide N-acetylgalactosaminyltransferase 7
          There are no transcripts associated with this gene.
          HMGB2 - high mobility group box 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001130688.1 816 UTR 3 NP_001124160.1
          NM_001130689.1 816 UTR 3 NP_001124161.1
          NM_002129.3 816 UTR 3 NP_002120.1
          LOC105377538 - uncharacterized LOC105377538
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of endothelial cell proliferation
          inflammatory response to antigenic stimulus
          DNA topological change
          apoptotic DNA fragmentation
          chromatin organization
          nucleosome assembly
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          spermatid nucleus differentiation
          male gonad development
          positive regulation of nuclease activity
          DNA geometric change
          response to lipopolysaccharide
          positive regulation of interferon-beta production
          V(D)J recombination
          response to drug
          positive regulation of DNA binding
          innate immune response
          positive regulation of innate immune response
          positive regulation of erythrocyte differentiation
          positive regulation of megakaryocyte differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          response to steroid hormone
          regulation of neurogenesis
          defense response to Gram-negative bacterium
          defense response to Gram-positive bacterium
          positive chemotaxis
          DNA ligation involved in DNA repair
          cell chemotaxis
          cellular response to lipopolysaccharide
          regulation of stem cell proliferation
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          four-way junction DNA binding
          enhancer sequence-specific DNA binding
          DNA binding
          damaged DNA binding
          double-stranded DNA binding
          single-stranded DNA binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          transcription factor binding
          drug binding
          DNA binding, bending
          protein domain specific binding
          chemoattractant activity
          transcription regulatory region DNA binding
          non-sequence-specific DNA binding, bending
          poly(A) RNA binding
          RAGE receptor binding
          supercoiled DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fbg7s:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline