Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__27841322_10
          See other ADCYAP1 GT Assays ›
          SNP ID:
          rs8095096
          Gene
          ADCYAP1
          Gene Name
          adenylate cyclase activating polypeptide 1
          Set Membership:
          -
          Chromosome Location:
          Chr.18: 908810 - 908810 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          ACAGTTTTGCTCACGCCAGAGAAAC[C/T]GAGAGCACAGGGCTTGTGTGAAGCC

          Assay ID C__27841322_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 102980

          Literature Links:

          ADCYAP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.36)
          (0.64)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.43)
          (0.57)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.28)
          (0.72)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.39)
          (0.61)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.34)
          (0.66)
          AMR
          T (0.33)
          (0.67)
          ADCYAP1 - adenylate cyclase activating polypeptide 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001099733.1 Intron NP_001093203.1
          NM_001117.4 Intron NP_001108.2
          XM_005258081.3 Intron XP_005258138.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          neuropeptide

          Gene Ontology Categories:

          Function(s) Process(es)

          ovarian follicle development
          behavioral fear response
          histamine secretion
          negative regulation of acute inflammatory response to antigenic stimulus
          negative regulation of acute inflammatory response to non-antigenic stimulus
          activation of adenylate cyclase activity
          positive regulation of cytosolic calcium ion concentration
          neuropeptide signaling pathway
          cell-cell signaling
          female pregnancy
          regulation of G-protein coupled receptor protein signaling pathway
          positive regulation of cell proliferation
          positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway
          negative regulation of muscle cell apoptotic process
          positive regulation of neuron projection development
          sensory perception of pain
          cAMP-mediated signaling
          pituitary gland development
          neuron projection development
          positive regulation of interleukin-6 production
          regulation of protein localization
          negative regulation of GTPase activity
          response to starvation
          negative regulation of potassium ion transport
          positive regulation of GTPase activity
          response to ethanol
          negative regulation of cell cycle
          positive regulation of protein kinase activity
          positive regulation of vasodilation
          positive regulation of transcription from RNA polymerase II promoter
          ATP metabolic process
          positive regulation of synaptic transmission, glutamatergic
          regulation of postsynaptic membrane potential
          positive regulation of growth hormone secretion
          negative regulation of glial cell proliferation
          positive regulation of ERK1 and ERK2 cascade
          regulation of oligodendrocyte progenitor proliferation
          cellular response to glucocorticoid stimulus
          positive regulation of chemokine (C-C motif) ligand 5 production
          positive regulation of somatostatin secretion
          receptor signaling protein activity
          receptor binding
          neuropeptide hormone activity
          protein binding
          pituitary adenylate cyclase activating polypeptide activity
          pituitary adenylate cyclase-activating polypeptide receptor binding
          peptide hormone receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline