Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__29347861_10
          See other TCF7L2 GT Assays ›
          SNP ID:
          rs7903146
          Gene
          TCF7L2
          Gene Name
          transcription factor 7 like 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 112998590 - 112998590 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG

          Assay ID C__29347861_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602228

          Literature Links:

          TCF7L2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.23)
          (0.77)
          Caucasian - Not Available CEPH (CEU)
          T (0.28)
          (0.72)
          EAS
          T (0.02)
          (0.98)
          African American - Not Available YRI (Yoruba)
          T (0.26)
          (0.74)
          SAS
          T (0.30)
          (0.70)
          Chinese - Not Available JPT (Japanese)
          T (0.04)
          (0.96)
          AFR
          T (0.26)
          (0.74)
          Japanese - Not Available CHB (Han Chinese)
          T (0.02)
          (0.98)
          EUR
          T (0.32)
          (0.68)
          AMR
          T (0.24)
          (0.76)
          TCF7L2 - transcription factor 7 like 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001146274.1 Intron NP_001139746.1
          NM_001146283.1 Intron NP_001139755.1
          NM_001146284.1 Intron NP_001139756.1
          NM_001146285.1 Intron NP_001139757.1
          NM_001146286.1 Intron NP_001139758.1
          NM_001198525.1 Intron NP_001185454.1
          NM_001198526.1 Intron NP_001185455.1
          NM_001198527.1 Intron NP_001185456.1
          NM_001198528.1 Intron NP_001185457.1
          NM_001198529.1 Intron NP_001185458.1
          NM_001198530.1 Intron NP_001185459.1
          NM_001198531.1 Intron NP_001185460.1
          NM_030756.4 Intron NP_110383.2
          XM_005270071.1 Intron XP_005270128.1
          XM_005270075.1 Intron XP_005270132.1
          XM_005270077.1 Intron XP_005270134.1
          XM_005270078.1 Intron XP_005270135.1
          XM_005270079.1 Intron XP_005270136.1
          XM_005270080.1 Intron XP_005270137.1
          XM_005270084.1 Intron XP_005270141.1
          XM_005270085.1 Intron XP_005270142.1
          XM_005270086.1 Intron XP_005270143.1
          XM_005270088.1 Intron XP_005270145.1
          XM_005270089.1 Intron XP_005270146.1
          XM_005270091.2 Intron XP_005270148.1
          XM_005270092.1 Intron XP_005270149.1
          XM_005270093.2 Intron XP_005270150.1
          XM_005270094.2 Intron XP_005270151.1
          XM_005270095.1 Intron XP_005270152.1
          XM_005270096.2 Intron XP_005270153.1
          XM_005270100.1 Intron XP_005270157.1
          XM_005270101.2 Intron XP_005270158.1
          XM_005270102.1 Intron XP_005270159.1
          XM_005270103.1 Intron XP_005270160.1
          XM_005270104.1 Intron XP_005270161.1
          XM_011540109.1 Intron XP_011538411.1
          XM_011540110.1 Intron XP_011538412.1
          XM_011540111.1 Intron XP_011538413.1
          XM_011540113.2 Intron XP_011538415.1
          XM_011540116.1 Intron XP_011538418.1
          XM_017016584.1 Intron XP_016872073.1
          XM_017016585.1 Intron XP_016872074.1
          XM_017016586.1 Intron XP_016872075.1
          XM_017016587.1 Intron XP_016872076.1
          XM_017016588.1 Intron XP_016872077.1
          XM_017016589.1 Intron XP_016872078.1
          XM_017016590.1 Intron XP_016872079.1
          XM_017016591.1 Intron XP_016872080.1
          XM_017016592.1 Intron XP_016872081.1
          XM_017016593.1 Intron XP_016872082.1
          XM_017016594.1 Intron XP_016872083.1
          XM_017016595.1 Intron XP_016872084.1
          XM_017016596.1 Intron XP_016872085.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          DNA-binding transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          blood vessel development
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          cell cycle arrest
          Wnt signaling pathway, calcium modulating pathway
          cell proliferation
          response to glucose
          positive regulation of heparan sulfate proteoglycan biosynthetic process
          pancreas development
          positive regulation of insulin secretion
          positive regulation of protein binding
          regulation of hormone metabolic process
          glucose homeostasis
          negative regulation of sequence-specific DNA binding transcription factor activity
          maintenance of DNA repeat elements
          canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition
          fat cell differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of protein export from nucleus
          myoblast fate commitment
          regulation of smooth muscle cell proliferation
          positive regulation of protein kinase B signaling
          canonical Wnt signaling pathway
          negative regulation of canonical Wnt signaling pathway
          beta-catenin-TCF complex assembly
          negative regulation of type B pancreatic cell apoptotic process
          negative regulation of extrinsic apoptotic signaling pathway
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          RNA polymerase II repressing transcription factor binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          beta-catenin binding
          transcription factor binding
          protein kinase binding
          nuclear hormone receptor binding
          sequence-specific DNA binding
          transcription regulatory region DNA binding
          gamma-catenin binding
          armadillo repeat domain binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-9kpsn:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0