Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__29347861_10
          See other TCF7L2 GT Assays ›
          SNP ID:
          rs7903146
          Gene
          TCF7L2
          Gene Name
          transcription factor 7 like 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 112998590 - 112998590 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG

          Assay ID C__29347861_10
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602228

          Literature Links:

          TCF7L2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.23)
          (0.77)
          Caucasian - Not Available CEPH (CEU)
          T (0.28)
          (0.72)
          EAS
          T (0.02)
          (0.98)
          African American - Not Available YRI (Yoruba)
          T (0.26)
          (0.74)
          SAS
          T (0.30)
          (0.70)
          Chinese - Not Available JPT (Japanese)
          T (0.04)
          (0.96)
          AFR
          T (0.26)
          (0.74)
          Japanese - Not Available CHB (Han Chinese)
          T (0.02)
          (0.98)
          EUR
          T (0.32)
          (0.68)
          AMR
          T (0.24)
          (0.76)
          TCF7L2 - transcription factor 7 like 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001146274.1 Intron NP_001139746.1
          NM_001146283.1 Intron NP_001139755.1
          NM_001146284.1 Intron NP_001139756.1
          NM_001146285.1 Intron NP_001139757.1
          NM_001146286.1 Intron NP_001139758.1
          NM_001198525.1 Intron NP_001185454.1
          NM_001198526.1 Intron NP_001185455.1
          NM_001198527.1 Intron NP_001185456.1
          NM_001198528.1 Intron NP_001185457.1
          NM_001198529.1 Intron NP_001185458.1
          NM_001198530.1 Intron NP_001185459.1
          NM_001198531.1 Intron NP_001185460.1
          NM_030756.4 Intron NP_110383.2
          XM_005270071.1 Intron XP_005270128.1
          XM_005270075.1 Intron XP_005270132.1
          XM_005270077.1 Intron XP_005270134.1
          XM_005270078.1 Intron XP_005270135.1
          XM_005270079.1 Intron XP_005270136.1
          XM_005270080.1 Intron XP_005270137.1
          XM_005270084.1 Intron XP_005270141.1
          XM_005270085.1 Intron XP_005270142.1
          XM_005270086.1 Intron XP_005270143.1
          XM_005270088.1 Intron XP_005270145.1
          XM_005270089.1 Intron XP_005270146.1
          XM_005270091.2 Intron XP_005270148.1
          XM_005270092.1 Intron XP_005270149.1
          XM_005270093.2 Intron XP_005270150.1
          XM_005270094.2 Intron XP_005270151.1
          XM_005270095.1 Intron XP_005270152.1
          XM_005270096.2 Intron XP_005270153.1
          XM_005270100.1 Intron XP_005270157.1
          XM_005270101.2 Intron XP_005270158.1
          XM_005270102.1 Intron XP_005270159.1
          XM_005270103.1 Intron XP_005270160.1
          XM_005270104.1 Intron XP_005270161.1
          XM_011540109.1 Intron XP_011538411.1
          XM_011540110.1 Intron XP_011538412.1
          XM_011540111.1 Intron XP_011538413.1
          XM_011540113.2 Intron XP_011538415.1
          XM_011540116.1 Intron XP_011538418.1
          XM_017016584.1 Intron XP_016872073.1
          XM_017016585.1 Intron XP_016872074.1
          XM_017016586.1 Intron XP_016872075.1
          XM_017016587.1 Intron XP_016872076.1
          XM_017016588.1 Intron XP_016872077.1
          XM_017016589.1 Intron XP_016872078.1
          XM_017016590.1 Intron XP_016872079.1
          XM_017016591.1 Intron XP_016872080.1
          XM_017016592.1 Intron XP_016872081.1
          XM_017016593.1 Intron XP_016872082.1
          XM_017016594.1 Intron XP_016872083.1
          XM_017016595.1 Intron XP_016872084.1
          XM_017016596.1 Intron XP_016872085.1

          Back To Top

          추가 정보


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          DNA-binding transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          blood vessel development
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          cell cycle arrest
          Wnt signaling pathway, calcium modulating pathway
          cell proliferation
          response to glucose
          positive regulation of heparan sulfate proteoglycan biosynthetic process
          pancreas development
          positive regulation of insulin secretion
          positive regulation of protein binding
          regulation of hormone metabolic process
          glucose homeostasis
          negative regulation of sequence-specific DNA binding transcription factor activity
          maintenance of DNA repeat elements
          canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition
          fat cell differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of protein export from nucleus
          myoblast fate commitment
          regulation of smooth muscle cell proliferation
          positive regulation of protein kinase B signaling
          canonical Wnt signaling pathway
          negative regulation of canonical Wnt signaling pathway
          beta-catenin-TCF complex assembly
          negative regulation of type B pancreatic cell apoptotic process
          negative regulation of extrinsic apoptotic signaling pathway
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          RNA polymerase II repressing transcription factor binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          beta-catenin binding
          transcription factor binding
          protein kinase binding
          nuclear hormone receptor binding
          sequence-specific DNA binding
          transcription regulatory region DNA binding
          gamma-catenin binding
          armadillo repeat domain binding

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-blue-fcf5f9d6d-kppxg:80/100.66.77.222:80.
          git-commit: 856de8fa7eff2d55603d92afdf035972e45c3e8a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.51.0-2026.05.21-1.0