Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__29433368_10
          See other EPB41L2 GT Assays ›
          SNP ID:
          rs6920685
          Gene
          EPB41L2 SMLR1
          Gene Name
          erythrocyte membrane protein band 4.1 like 2
          small leucine rich protein 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 130831029 - 130831029 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TAAACTTGCTTTCACTTTACGAACT[C/T]GCCCTTAATTCTTTCTTGTGCAAGA

          Assay ID C__29433368_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603237

          Literature Links:

          EPB41L2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.03)
          (0.97)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          T (0.16)
          (0.84)
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.10)
          (0.90)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.01)
          (0.99)
          EPB41L2 - erythrocyte membrane protein band 4.1 like 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001135554.1 Intron NP_001129026.1
          NM_001135555.3 Intron NP_001129027.1
          NM_001199388.2 Intron NP_001186317.1
          NM_001252660.1 Intron NP_001239589.1
          NM_001431.3 Intron NP_001422.1
          XM_006715362.2 Intron XP_006715425.1
          XM_011535524.1 Intron XP_011533826.1
          XM_011535525.1 Intron XP_011533827.1
          XM_011535527.1 Intron XP_011533829.1
          XM_011535528.1 Intron XP_011533830.1
          XM_011535529.1 Intron XP_011533831.1
          XM_011535530.1 Intron XP_011533832.1
          XM_011535534.1 Intron XP_011533836.1
          XM_011535536.1 Intron XP_011533838.1
          XM_017010349.1 Intron XP_016865838.1
          XM_017010350.1 Intron XP_016865839.1
          XM_017010351.1 Intron XP_016865840.1
          XM_017010352.1 Intron XP_016865841.1
          XM_017010353.1 Intron XP_016865842.1
          XM_017010354.1 Intron XP_016865843.1
          XM_017010355.1 Intron XP_016865844.1
          XM_017010356.1 Intron XP_016865845.1
          XM_017010357.1 Intron XP_016865846.1
          XM_017010358.1 Intron XP_016865847.1
          XM_017010359.1 Intron XP_016865848.1
          XM_017010360.1 Intron XP_016865849.1
          XM_017010361.1 Intron XP_016865850.1
          XM_017010362.1 Intron XP_016865851.1
          XM_017010363.1 Intron XP_016865852.1
          XM_017010364.1 Intron XP_016865853.1
          SMLR1 - small leucine rich protein 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001195597.1 Intron NP_001182526.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          cortical actin cytoskeleton organization
          actin binding
          structural molecule activity
          spectrin binding
          PH domain binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-6479c7f679-jmhj8:80/100.66.74.142:80.
          git-commit: b70c0dceb888abc3b0dcebb5bc3a5b8753e7e816
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.50.0-Offline