Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__29564898_10
          See other ARHGEF7 GT Assays ›
          SNP ID:
          rs9588366
          Gene
          ARHGEF7 ARHGEF7-AS1 LOC101060553
          Gene Name
          Rho guanine nucleotide exchange factor 7
          ARHGEF7 antisense RNA 1
          uncharacterized LOC101060553
          Set Membership:
          -
          Chromosome Location:
          Chr.13: 111155201 - 111155201 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CCAATTCCCTGCTGATAAAAAGGGA[C/T]AACTGTATATGAAAGCATCTTTGTA

          Assay ID C__29564898_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605477

          Literature Links:

          ARHGEF7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.07)
          (0.93)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.01)
          (0.99)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.19)
          (0.81)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.04)
          (0.96)
          AMR
          T (0.04)
          (0.96)
          ARHGEF7 - Rho guanine nucleotide exchange factor 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001113511.2 Intron NP_001106983.1
          NM_001113512.2 Intron NP_001106984.1
          NM_001113513.1 Intron NP_001106985.1
          NM_001320851.1 Intron NP_001307780.1
          NM_001320852.1 Intron NP_001307781.1
          NM_001320853.1 Intron NP_001307782.1
          NM_001320854.1 Intron NP_001307783.1
          NM_003899.3 Intron NP_003890.1
          NM_145735.3 Intron NP_663788.1
          XM_006719956.3 Intron XP_006720019.1
          XM_011521133.2 Intron XP_011519435.1
          XM_017020814.1 Intron XP_016876303.1
          XM_017020815.1 Intron XP_016876304.1
          XM_017020816.1 Intron XP_016876305.1
          XM_017020817.1 Intron XP_016876306.1
          XM_017020818.1 Intron XP_016876307.1
          XM_017020819.1 Intron XP_016876308.1
          XM_017020820.1 Intron XP_016876309.1
          XM_017020821.1 Intron XP_016876310.1
          XM_017020822.1 Intron XP_016876311.1
          XM_017020823.1 Intron XP_016876312.1
          XM_017020824.1 Intron XP_016876313.1
          XM_017020825.1 Intron XP_016876314.1
          XM_017020826.1 Intron XP_016876315.1
          XM_017020827.1 Intron XP_016876316.1
          XM_017020828.1 Intron XP_016876317.1
          XM_017020829.1 Intron XP_016876318.1
          ARHGEF7-AS1 - ARHGEF7 antisense RNA 1
          There are no transcripts associated with this gene.
          LOC101060553 - uncharacterized LOC101060553
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          guanyl-nucleotide exchange factor

          Gene Ontology Categories:

          Function(s) Process(es)

          hematopoietic progenitor cell differentiation
          Golgi organization
          signal transduction
          nervous system development
          positive regulation of fibroblast migration
          lamellipodium assembly
          positive regulation of protein binding
          regulation of Rho protein signal transduction
          intracellular signal transduction
          negative regulation of epidermal growth factor receptor signaling pathway
          positive regulation of apoptotic process
          positive regulation of GTPase activity
          ephrin receptor signaling pathway
          focal adhesion assembly
          regulation of small GTPase mediated signal transduction
          positive regulation of growth hormone secretion
          positive regulation of substrate adhesion-dependent cell spreading
          regulation of GTP binding
          positive regulation of lamellipodium morphogenesis
          guanyl-nucleotide exchange factor activity
          Rho guanyl-nucleotide exchange factor activity
          protein binding
          protein kinase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline