Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__29778913_10
          See other RIPK1 GT Assays ›
          SNP ID:
          rs9503387
          Gene
          RIPK1
          Gene Name
          receptor interacting serine/threonine kinase 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 3073888 - 3073888 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AGTCTGAAGGTTACGTCCACCACGA[C/G]TATCGTCTTAACACCGCTTGCTTCA

          Assay ID C__29778913_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603453

          Literature Links:

          RIPK1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.07)
          (0.93)
          Caucasian - Not Available CEPH (CEU)
          G (0.04)
          (0.96)
          EAS
          G (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          G (0.21)
          (0.79)
          SAS
          G (0.03)
          (0.97)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.20)
          (0.80)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.04)
          (0.96)
          AMR
          G (0.04)
          (0.96)
          RIPK1 - receptor interacting serine/threonine kinase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          XM_005249457.3 Intron XP_005249514.2
          XM_006715237.3 Intron XP_006715300.2
          XM_017011403.1 Intron XP_016866892.1
          XM_017011404.1 Intron XP_016866893.1
          XM_017011405.1 Intron XP_016866894.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of protein phosphorylation
          apoptotic process
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          I-kappaB kinase/NF-kappaB signaling
          activation of JUN kinase activity
          regulation of tumor necrosis factor-mediated signaling pathway
          regulation of necrotic cell death
          positive regulation of necrotic cell death
          positive regulation of interleukin-8 production
          positive regulation of tumor necrosis factor production
          tumor necrosis factor-mediated signaling pathway
          response to tumor necrosis factor
          TRIF-dependent toll-like receptor signaling pathway
          peptidyl-serine autophosphorylation
          positive regulation of apoptotic process
          positive regulation of programmed cell death
          positive regulation of I-kappaB kinase/NF-kappaB signaling
          negative regulation of I-kappaB kinase/NF-kappaB signaling
          cellular protein catabolic process
          positive regulation of macrophage differentiation
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of JNK cascade
          protein autophosphorylation
          positive regulation of NF-kappaB transcription factor activity
          protein homooligomerization
          protein heterooligomerization
          positive regulation of necroptotic process
          T cell apoptotic process
          necroptotic process
          regulation of ATP:ADP antiporter activity
          cellular response to tumor necrosis factor
          cellular response to growth factor stimulus
          death-inducing signaling complex assembly
          apoptotic signaling pathway
          extrinsic apoptotic signaling pathway
          activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway
          ripoptosome assembly
          necroptotic signaling pathway
          ripoptosome assembly involved in necroptotic process
          regulation of extrinsic apoptotic signaling pathway via death domain receptors
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          positive regulation of hydrogen peroxide-induced cell death
          amyloid fibril formation
          positive regulation of reactive oxygen species metabolic process
          negative regulation of extrinsic apoptotic signaling pathway
          positive regulation of extrinsic apoptotic signaling pathway
          negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
          protein kinase activity
          protein serine/threonine kinase activity
          death receptor binding
          protein binding
          ATP binding
          ubiquitin protein ligase binding
          protein complex binding
          identical protein binding
          death domain binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline