Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30108021_10
          See other CBFA2T2 GT Assays ›
          SNP ID:
          rs9679764
          Gene
          CBFA2T2
          Gene Name
          CBFA2/RUNX1 translocation partner 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.20: 33614973 - 33614973 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CCTACTATGTTAACTCTTTTTTGTA[C/T]AGAACCATTACAAATAATGTTCCTA

          Assay ID C__30108021_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603672

          Literature Links:

          CBFA2T2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.19)
          (0.81)
          Caucasian - Not Available CEPH (CEU)
          T (0.16)
          (0.84)
          EAS
          T (0.35)
          (0.65)
          African American - Not Available YRI (Yoruba)
          T (0.01)
          (0.99)
          SAS
          T (0.29)
          (0.71)
          Chinese - Not Available JPT (Japanese)
          T (0.36)
          (0.64)
          AFR
          T (0.03)
          (0.97)
          Japanese - Not Available CHB (Han Chinese)
          T (0.45)
          (0.55)
          EUR
          T (0.16)
          (0.84)
          AMR
          T (0.14)
          (0.86)
          CBFA2T2 - CBFA2/RUNX1 translocation partner 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001032999.2 Intron NP_001028171.1
          NM_001039709.1 Intron NP_001034798.1
          NM_005093.3 Intron NP_005084.1
          XM_011529101.2 Intron XP_011527403.1
          XM_011529102.2 Intron XP_011527404.1
          XM_011529103.2 Intron XP_011527405.1
          XM_011529107.2 Intron XP_011527409.1
          XM_017028121.1 Intron XP_016883610.1
          XM_017028122.1 Intron XP_016883611.1
          XM_017028123.1 Intron XP_016883612.1
          XM_017028124.1 Intron XP_016883613.1
          XM_017028125.1 Intron XP_016883614.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          transcription cofactor

          Gene Ontology Categories:

          Function(s) Process(es)

          transcription, DNA-templated
          positive regulation of neuron projection development
          negative regulation of neuron projection development
          epithelial cell differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          transcription factor activity, sequence-specific DNA binding
          transcription corepressor activity
          protein binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0