Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30292091_10
          See other MITF GT Assays ›
          SNP ID:
          rs9851608
          Gene
          MITF
          Gene Name
          melanogenesis associated transcription factor
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 69749361 - 69749361 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TTTTTAGCATTTGAATTTTTTCAGC[A/G]AAAGGTGGAAAGGTATTATTTCAGT

          Assay ID C__30292091_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 156845

          Literature Links:

          MITF PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.01)
          (0.99)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          MITF - melanogenesis associated transcription factor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000248.3 Intron NP_000239.1
          NM_001184967.1 Intron NP_001171896.1
          NM_001184968.1 Intron NP_001171897.1
          NM_006722.2 Intron NP_006713.1
          NM_198158.2 Intron NP_937801.1
          NM_198159.2 Intron NP_937802.1
          NM_198177.2 Intron NP_937820.1
          NM_198178.2 Intron NP_937821.2
          XM_005264754.1 Intron XP_005264811.1
          XM_005264755.3 Intron XP_005264812.1
          XM_006713164.2 Intron XP_006713227.1
          XM_011533722.2 Intron XP_011532024.1
          XM_011533723.2 Intron XP_011532025.1
          XM_011533725.1 Intron XP_011532027.1
          XM_011533726.1 Intron XP_011532028.1
          XM_017006444.1 Intron XP_016861933.1
          XM_017006445.1 Intron XP_016861934.1
          XM_017006446.1 Intron XP_016861935.1
          XM_017006447.1 Intron XP_016861936.1
          XM_017006448.1 Intron XP_016861937.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          regulation of transcription, DNA-templated
          transcription from RNA polymerase II promoter
          protein complex assembly
          multicellular organism development
          positive regulation of gene expression
          protein sumoylation
          melanocyte differentiation
          regulation of apoptotic process
          regulation of osteoclast differentiation
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          mast cell migration
          positive regulation of DNA-templated transcription, initiation
          regulation of RNA biosynthetic process
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcriptional repressor activity, RNA polymerase II transcription regulatory region sequence-specific binding
          protein binding
          protein dimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline