Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30301135_20
          See other ADGRL3 GT Assays ›
          SNP ID:
          rs9995919
          Gene
          ADGRL3
          Gene Name
          adhesion G protein-coupled receptor L3
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.4: 62008473 - 62008473 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          ATGTGATAAAATTATGACTGAGACC[G/T]GCTAACCTATTGACCAGTAGATGTT

          Assay ID C__30301135_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 616417

          Literature Links:

          ADGRL3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.13)
          (0.87)
          Caucasian - Not Available CEPH (CEU)
          G (0.07)
          (0.93)
          EAS
          G (0.16)
          (0.84)
          African American - Not Available YRI (Yoruba)
          G (0.29)
          (0.71)
          SAS
          G (0.04)
          (0.96)
          Chinese - Not Available JPT (Japanese)
          G (0.12)
          (0.88)
          AFR
          G (0.28)
          (0.72)
          Japanese - Not Available CHB (Han Chinese)
          G (0.12)
          (0.88)
          EUR
          G (0.06)
          (0.94)
          AMR
          G (0.06)
          (0.94)
          ADGRL3 - adhesion G protein-coupled receptor L3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001322246.1 Intron NP_001309175.1
          NM_001322402.1 Intron NP_001309331.1
          NM_015236.5 Intron NP_056051.2
          XM_011531788.2 Intron XP_011530090.1
          XM_011531791.2 Intron XP_011530093.1
          XM_017007929.1 Intron XP_016863418.1
          XM_017007930.1 Intron XP_016863419.1
          XM_017007931.1 Intron XP_016863420.1
          XM_017007932.1 Intron XP_016863421.1
          XM_017007933.1 Intron XP_016863422.1
          XM_017007934.1 Intron XP_016863423.1
          XM_017007935.1 Intron XP_016863424.1
          XM_017007936.1 Intron XP_016863425.1
          XM_017007937.1 Intron XP_016863426.1
          XM_017007938.1 Intron XP_016863427.1
          XM_017007939.1 Intron XP_016863428.1
          XM_017007940.1 Intron XP_016863429.1
          XM_017007941.1 Intron XP_016863430.1
          XM_017007942.1 Intron XP_016863431.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          neuron migration
          cell surface receptor signaling pathway
          G-protein coupled receptor signaling pathway
          synapse assembly
          locomotion involved in locomotory behavior
          response to cocaine
          positive regulation of synapse assembly
          cell-cell adhesion
          G-protein coupled receptor activity
          calcium ion binding
          protein binding
          carbohydrate binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fkn7b:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline