Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30401246_10
          See other SNCA GT Assays ›
          SNP ID:
          rs9762836
          Gene
          SNCA
          Gene Name
          synuclein alpha
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.4: 89787356 - 89787356 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GCCCCCTGTAGGTATGATTACATTC[C/T]GCATACTAATTCTTCTTGAGCTCAC

          Assay ID C__30401246_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 163890

          Literature Links:

          SNCA PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.02)
          (0.98)
          Caucasian - Not Available CEPH (CEU)
          T (0.00)
          (1.00)
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          T (0.03)
          (0.97)
          SAS
          T (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.03)
          (0.97)
          Japanese - Not Available JPT (Japanese)
          T (0.01)
          (0.99)
          EUR
          T (0.01)
          (0.99)
          AMR
          T (0.09)
          (0.91)
          SNCA - synuclein alpha
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000345.3 Intron NP_000336.1
          NM_001146054.1 Intron NP_001139526.1
          NM_001146055.1 Intron NP_001139527.1
          NM_007308.2 Intron NP_009292.1
          XM_011532203.1 Intron XP_011530505.1
          XM_011532204.2 Intron XP_011530506.1
          XM_011532205.2 Intron XP_011530507.1
          XM_011532206.1 Intron XP_011530508.1
          XM_011532207.1 Intron XP_011530509.1
          XM_011532208.2 Intron XP_011530510.1
          XM_017008562.1 Intron XP_016864051.1
          XM_017008563.1 Intron XP_016864052.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          membrane trafficking regulatory protein

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          microglial cell activation
          positive regulation of receptor recycling
          negative regulation of protein phosphorylation
          positive regulation of neurotransmitter secretion
          fatty acid metabolic process
          neutral lipid metabolic process
          phospholipid metabolic process
          apoptotic process
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          mitochondrial membrane organization
          aging
          adult locomotory behavior
          response to iron(II) ion
          regulation of phospholipase activity
          negative regulation of platelet-derived growth factor receptor signaling pathway
          regulation of glutamate secretion
          regulation of dopamine secretion
          negative regulation of microtubule polymerization
          receptor internalization
          protein destabilization
          response to magnesium ion
          negative regulation of transporter activity
          response to lipopolysaccharide
          negative regulation of monooxygenase activity
          positive regulation of peptidyl-serine phosphorylation
          response to interferon-gamma
          cellular response to oxidative stress
          negative regulation of histone acetylation
          regulation of locomotion
          dopamine biosynthetic process
          response to drug
          mitochondrial ATP synthesis coupled electron transport
          regulation of macrophage activation
          positive regulation of apoptotic process
          negative regulation of apoptotic process
          negative regulation of cysteine-type endopeptidase activity involved in apoptotic process
          extracellular fibril organization
          negative regulation of neuron apoptotic process
          cellular protein metabolic process
          cellular response to fibroblast growth factor stimulus
          positive regulation of endocytosis
          negative regulation of exocytosis
          negative regulation of dopamine metabolic process
          behavioral response to cocaine
          regulation of long-term neuronal synaptic plasticity
          synaptic vesicle endocytosis
          synapse organization
          regulation of acyl-CoA biosynthetic process
          positive regulation of release of sequestered calcium ion into cytosol
          dopamine uptake involved in synaptic transmission
          negative regulation of dopamine uptake involved in synaptic transmission
          negative regulation of serotonin uptake
          negative regulation of norepinephrine uptake
          calcium ion homeostasis
          oxidation-reduction process
          excitatory postsynaptic potential
          long-term synaptic potentiation
          positive regulation of inositol phosphate biosynthetic process
          negative regulation of thrombin receptor signaling pathway
          response to interleukin-1
          cellular response to copper ion
          cellular response to epinephrine stimulus
          positive regulation of protein serine/threonine kinase activity
          negative regulation of neuron death
          negative regulation of mitochondrial electron transport, NADH to ubiquinone
          positive regulation of glutathione peroxidase activity
          positive regulation of hydrogen peroxide catabolic process
          regulation of synaptic vesicle recycling
          regulation of reactive oxygen species biosynthetic process
          negative regulation of chaperone-mediated autophagy
          magnesium ion binding
          fatty acid binding
          copper ion binding
          calcium ion binding
          protein binding
          phospholipid binding
          microtubule binding
          ferrous iron binding
          zinc ion binding
          oxidoreductase activity
          kinesin binding
          protein domain specific binding
          histone binding
          identical protein binding
          alpha-tubulin binding
          cysteine-type endopeptidase inhibitor activity involved in apoptotic process
          phospholipase binding
          transcription regulatory region DNA binding
          dynein binding
          protein N-terminus binding
          tau protein binding
          beta-tubulin binding
          phosphoprotein binding
          phospholipase D inhibitor activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-d59m7:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0