Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30454335_10
          See other ROBO2 GT Assays ›
          SNP ID:
          rs9989960
          Gene
          ROBO2
          Gene Name
          roundabout guidance receptor 2
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 76099717 - 76099717 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          AAAATTTCTGATTTTTTTCTCTAAA[A/T]AAATTTTCACTTATTAAAATGTTTT

          Assay ID C__30454335_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602431

          Literature Links:

          ROBO2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.30)
          (0.70)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ROBO2 - roundabout guidance receptor 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001128929.3 Intron NP_001122401.1
          NM_001290039.1 Intron NP_001276968.1
          NM_001290040.1 Intron NP_001276969.1
          NM_001290065.1 Intron NP_001276994.1
          NM_002942.4 Intron NP_002933.1
          XM_011533981.2 Intron XP_011532283.1
          XM_011533982.1 Intron XP_011532284.1
          XM_011533983.1 Intron XP_011532285.1
          XM_011533984.1 Intron XP_011532286.1
          XM_011533985.1 Intron XP_011532287.1
          XM_017006986.1 Intron XP_016862475.1
          XM_017006987.1 Intron XP_016862476.1
          XM_017006988.1 Intron XP_016862477.1
          XM_017006989.1 Intron XP_016862478.1
          XM_017006990.1 Intron XP_016862479.1
          XM_017006991.1 Intron XP_016862480.1
          XM_017006992.1 Intron XP_016862481.1
          XM_017006993.1 Intron XP_016862482.1
          XM_017006994.1 Intron XP_016862483.1
          XM_017006995.1 Intron XP_016862484.1
          XM_017006996.1 Intron XP_016862485.1
          XM_017006997.1 Intron XP_016862486.1
          XM_017006998.1 Intron XP_016862487.1
          XM_017006999.1 Intron XP_016862488.1
          XM_017007000.1 Intron XP_016862489.1
          XM_017007001.1 Intron XP_016862490.1
          XM_017007002.1 Intron XP_016862491.1
          XM_017007003.1 Intron XP_016862492.1
          XM_017007004.1 Intron XP_016862493.1
          XM_017007005.1 Intron XP_016862494.1
          XM_017007006.1 Intron XP_016862495.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          metanephros development
          ureteric bud development
          homophilic cell adhesion via plasma membrane adhesion molecules
          axon guidance
          central nervous system development
          brain development
          axon midline choice point recognition
          olfactory bulb interneuron development
          retinal ganglion cell axon guidance
          cellular response to hormone stimulus
          Roundabout signaling pathway
          positive regulation of axonogenesis
          negative regulation of negative chemotaxis
          negative regulation of synapse assembly
          apoptotic process involved in luteolysis
          protein binding
          axon guidance receptor activity
          identical protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline