Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30535447_10
          See other ADGRL3 GT Assays ›
          SNP ID:
          rs9995332
          Gene
          ADGRL3 ADGRL3-AS1
          Gene Name
          adhesion G protein-coupled receptor L3
          adhesion G protein-coupled receptor L3 antisense RNA 1
          Set Membership:
          -
          Chromosome Location:
          Chr.4: 62061884 - 62061884 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          CCAGTTGAAGGAAATTTGGGTTGTT[T/C]CCAGTTTGGAGCTACTACAAATAAA

          Assay ID C__30535447_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 616417

          Literature Links:

          ADGRL3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.03)
          (0.97)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.11)
          (0.89)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.00)
          (1.00)
          AMR
          C (0.00)
          (1.00)
          ADGRL3 - adhesion G protein-coupled receptor L3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001322246.1 Intron NP_001309175.1
          NM_001322402.1 Intron NP_001309331.1
          NM_015236.5 Intron NP_056051.2
          XM_011531788.2 Intron XP_011530090.1
          XM_011531791.2 Intron XP_011530093.1
          XM_017007929.1 Intron XP_016863418.1
          XM_017007930.1 Intron XP_016863419.1
          XM_017007931.1 Intron XP_016863420.1
          XM_017007932.1 Intron XP_016863421.1
          XM_017007933.1 Intron XP_016863422.1
          XM_017007934.1 Intron XP_016863423.1
          XM_017007935.1 Intron XP_016863424.1
          XM_017007936.1 Intron XP_016863425.1
          XM_017007937.1 Intron XP_016863426.1
          XM_017007938.1 Intron XP_016863427.1
          XM_017007939.1 Intron XP_016863428.1
          XM_017007940.1 Intron XP_016863429.1
          XM_017007941.1 Intron XP_016863430.1
          XM_017007942.1 Intron XP_016863431.1
          ADGRL3-AS1 - adhesion G protein-coupled receptor L3 antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          neuron migration
          cell surface receptor signaling pathway
          G-protein coupled receptor signaling pathway
          synapse assembly
          locomotion involved in locomotory behavior
          response to cocaine
          positive regulation of synapse assembly
          cell-cell adhesion
          G-protein coupled receptor activity
          calcium ion binding
          protein binding
          carbohydrate binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fbg7s:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline