Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30550431_10
          See other ANK1 GT Assays ›
          SNP ID:
          rs9694721
          Gene
          ANK1
          Gene Name
          ankyrin 1
          Set Membership:
          -
          Chromosome Location:
          Chr.8: 41859828 - 41859828 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          GGAGCTTTAAAAGTCCAAGCAGGGG[C/G]TCCAGGCTGGCCGCAGCAACAACAG

          Assay ID C__30550431_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 612641

          Literature Links:

          ANK1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ANK1 - ankyrin 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000037.3 Intron NP_000028.3
          NM_001142445.1 Intron NP_001135917.1
          NM_001142446.1 Intron NP_001135918.1
          NM_020475.2 Intron NP_065208.2
          NM_020476.2 Intron NP_065209.2
          NM_020477.2 Intron NP_065210.2
          NM_020478.4 Intron NP_065211.2
          NM_020480.4 Intron NP_065213.2
          XM_005273476.4 Intron XP_005273533.1
          XM_011544490.2 Intron XP_011542792.1
          XM_011544491.2 Intron XP_011542793.1
          XM_011544494.2 Intron XP_011542796.1
          XM_011544495.2 Intron XP_011542797.1
          XM_011544496.2 Intron XP_011542798.1
          XM_011544500.2 Intron XP_011542802.1
          XM_011544501.2 Intron XP_011542803.1
          XM_011544502.2 Intron XP_011542804.1
          XM_011544503.2 Intron XP_011542805.1
          XM_011544504.2 Intron XP_011542806.1
          XM_011544505.2 Intron XP_011542807.1
          XM_017013319.1 Intron XP_016868808.1
          XM_017013320.1 Intron XP_016868809.1
          XM_017013321.1 Intron XP_016868810.1
          XM_017013322.1 Intron XP_016868811.1
          XM_017013323.1 Intron XP_016868812.1
          XM_017013324.1 Intron XP_016868813.1
          XM_017013325.1 Intron XP_016868814.1
          XM_017013326.1 Intron XP_016868815.1
          XM_017013327.1 Intron XP_016868816.1
          XM_017013328.1 Intron XP_016868817.1
          XM_017013329.1 Intron XP_016868818.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          exocytosis
          ER to Golgi vesicle-mediated transport
          cytoskeleton organization
          signal transduction
          positive regulation of organelle organization
          maintenance of epithelial cell apical/basal polarity
          protein targeting to plasma membrane
          structural molecule activity
          structural constituent of cytoskeleton
          protein binding
          cytoskeletal adaptor activity
          enzyme binding
          spectrin binding
          ATPase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-9kpsn:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0