Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CCAAGGGTTATGAAGGATGAGTGAA[C/T]ATAAGATGGATGTGGAGGCTGCATT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
ZIK1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ZIK1 - zinc finger protein interacting with K protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF530 - zinc finger protein 530 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321981.1 | Intron | NP_001308910.1 | ||||
NM_020880.4 | Intron | NP_065931.3 | ||||
XM_006723194.1 | Intron | XP_006723257.1 | ||||
XM_011526919.2 | Intron | XP_011525221.1 | ||||
XM_011526921.2 | Intron | XP_011525223.1 |