Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Quem atendemos
    • Setor de Biotecnologia
    • Indústria Biofarmacêutica
    • CDMO
    • Diagnósticos Laboratoriais
    • Ciência Industrial e Aplicada
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30634099_10
          See other SLC22A1 GT Assays ›
          SNP ID:
          rs34447885
          Gene
          SLC22A1
          Gene Name
          solute carrier family 22 member 1
          Set Membership:
          > DME > Validated > Inventoried
          Chromosome Location:
          Chr.6: 160121976 - 160121976 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GACATTCTGGAGCAGGTTGGGGAGT[C/T]TGGCTGGTTCCAGAAGCAAGCCTTC

          Assay ID C__30634099_10
          Size VIC-FAM | 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602607

          Literature Links:

          SLC22A1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.01)
          (0.99)
          Caucasian
          T (0.00)
          (1.00)
          CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American
          T (0.02)
          (0.98)
          YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Japanese
          T (0.00)
          (1.00)
          CHB (Han Chinese) - Not Available
          AFR
          T (0.02)
          (0.98)
          Chinese
          T (0.00)
          (1.00)
          JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          SLC22A1 - solute carrier family 22 member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_003057.2 188 Missense Mutation TCT,TTT S,F 14 NP_003048.1
          NM_153187.1 188 Missense Mutation TCT,TTT S,F 14 NP_694857.1
          XM_005267102.4 188 Missense Mutation TCT,TTT S,F 14 XP_005267159.1
          XM_005267103.1 188 Missense Mutation TCT,TTT S,F 14 XP_005267160.1
          XM_005267104.4 188 Intron XP_005267161.1
          XM_005267105.4 188 Intron XP_005267162.1
          XM_006715552.1 188 Missense Mutation TCT,TTT S,F 14 XP_006715615.1
          XM_011536074.2 188 Intron XP_011534376.1

          Back To Top

          More Information


          Set Membership:

          DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          secondary carrier transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          neurotransmitter transport
          drug transmembrane transport
          establishment or maintenance of transmembrane electrochemical gradient
          organic cation transport
          quaternary ammonium group transport
          dopamine transport
          norepinephrine transport
          epinephrine transport
          protein homooligomerization
          ammonium transmembrane transport
          acetate ester transport
          acetylcholine transmembrane transporter activity
          dopamine transmembrane transporter activity
          norepinephrine transmembrane transporter activity
          protein binding
          secondary active organic cation transmembrane transporter activity
          organic cation transmembrane transporter activity
          quaternary ammonium group transmembrane transporter activity
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-blue-7c59b9b899-7wltc:80/100.66.72.81:80.
          git-commit: 8ef7cf686e3c81d28b13492708ce56d167b2f995
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.49.0-Offline