Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30634099_10
          See other SLC22A1 GT Assays ›
          SNP ID:
          rs34447885
          Gene
          SLC22A1
          Gene Name
          solute carrier family 22 member 1
          Set Membership:
          > DME > Validated > Inventoried
          Chromosome Location:
          Chr.6: 160121976 - 160121976 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GACATTCTGGAGCAGGTTGGGGAGT[C/T]TGGCTGGTTCCAGAAGCAAGCCTTC

          Assay ID C__30634099_10
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602607

          Literature Links:

          SLC22A1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.01)
          (0.99)
          Caucasian
          T (0.00)
          (1.00)
          CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American
          T (0.02)
          (0.98)
          YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Japanese
          T (0.00)
          (1.00)
          CHB (Han Chinese) - Not Available
          AFR
          T (0.02)
          (0.98)
          Chinese
          T (0.00)
          (1.00)
          JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          SLC22A1 - solute carrier family 22 member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_003057.2 188 Missense Mutation TCT,TTT S,F 14 NP_003048.1
          NM_153187.1 188 Missense Mutation TCT,TTT S,F 14 NP_694857.1
          XM_005267102.4 188 Missense Mutation TCT,TTT S,F 14 XP_005267159.1
          XM_005267103.1 188 Missense Mutation TCT,TTT S,F 14 XP_005267160.1
          XM_005267104.4 188 Intron XP_005267161.1
          XM_005267105.4 188 Intron XP_005267162.1
          XM_006715552.1 188 Missense Mutation TCT,TTT S,F 14 XP_006715615.1
          XM_011536074.2 188 Intron XP_011534376.1

          Back To Top

          More Information


          Set Membership:

          DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          secondary carrier transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          neurotransmitter transport
          drug transmembrane transport
          establishment or maintenance of transmembrane electrochemical gradient
          organic cation transport
          quaternary ammonium group transport
          dopamine transport
          norepinephrine transport
          epinephrine transport
          protein homooligomerization
          ammonium transmembrane transport
          acetate ester transport
          acetylcholine transmembrane transporter activity
          dopamine transmembrane transporter activity
          norepinephrine transmembrane transporter activity
          protein binding
          secondary active organic cation transmembrane transporter activity
          organic cation transmembrane transporter activity
          quaternary ammonium group transmembrane transporter activity
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-f5k2k:80/100.66.78.196:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0