Search
LOADING 
- SNP ID:
- rs201377835
- Gene
-
CYP2D6LOC102723722NDUFA6-AS1 - Gene Name
- Set Membership:
- > DME > Validated > Inventoried
- Chromosome Location:
- Chr.22: 42129910 - 42129910 on Build GRCh38
- Polymorphism:
- C/G, Transversion substitution
- Context Sequence [VIC/FAM]:
ACACGTCCCCGAAGCGGCGCCGCAA[C/G]TGCAGAGGGAGGGTCAGGGCCTCTT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 124030
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CYP2D6 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
CYP2D6*11,g.883G>C
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | ||||||
|---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU) - Not Available | ||||||
EAS
|
African American
|
YRI (Yoruba) - Not Available | ||||||
SAS
|
Japanese
|
CHB (Han Chinese) - Not Available | ||||||
AFR
|
Chinese
|
JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
| CYP2D6 - cytochrome P450 family 2 subfamily D member 6 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000106.5 | Intron | NP_000097.3 | ||||
| NM_001025161.2 | Intron | NP_001020332.2 | ||||
| XM_011529966.2 | Intron | XP_011528268.1 | ||||
| XM_011529968.2 | Intron | XP_011528270.1 | ||||
| XM_011529970.2 | Intron | XP_011528272.1 | ||||
| XM_011529972.2 | Intron | XP_011528274.1 | ||||
| LOC102723722 - uncharacterized LOC102723722 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| XM_017029174.1 | Intron | XP_016884663.1 | ||||
| NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To TopMore Information
Important Information
Assay C__30634118_A0 targets the CYP2D6*11 g.883G>C rs201377835 SNP. It specifically amplifies CYP2D6 sequences using primers that bind to sites that differ in sequence with the CYP2D7 pseudogene. Two of these base differences occur as SNPs (rs28371704 g.984A>G and rs28371703 g.974C>A) that are found in certain CYP2D6*4 suballeles, which cannot be amplified by C__30634118_A0. The C__27102431_D0 assay to CYP2D6*4 g.1846G>A should be run on the same samples as the *11 assay for proper genotype analysis. Samples that do not amplify with C__30634118_A0 may have the *4/*4 genotype, and samples that run as *11/*11 may have *11/*11 or *4/*11 genotypes. Custom assay ANXG2FG to rs201377835, which doesn't overlie the *4 SNP, is available if needed.Additional Information:
The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
For this assay, SNP(s) [rs28371703,rs28371704] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance. For more information, refer to the assay Important Information note.
For this assay, SNP(s) [rs28371703,rs28371704] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance. For more information, refer to the assay Important Information note.
Set Membership: |
DME
Validated
Inventoried
|
Panther Classification:
Gene Ontology Categories:
Back To Top