Search
LOADING 
- SNP ID:
- rs56165452
- Gene
-
CYP2C9 - Gene Name
- Set Membership:
- > DME > Validated > Inventoried
- Chromosome Location:
- Chr.10: 94981297 - 94981297 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
GTGGTGCACGAGGTCCAGAGATACA[C/T]TGACCTTCTCCCCACCAGCCTGCCC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601130
|
||||||||||||||||||||||||||||||||
Literature Links: |
CYP2C9 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
CYP2C9*4,c.1076T>C
CYP2C9*4,g.42615T>C
|
||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | |||
|---|---|---|---|---|---|
| Global - Not Available | Caucasian
|
CEPH (CEU) - Not Available | |||
| EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | |||
| SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | |||
| AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | |||
| EUR - Not Available | |||||
| AMR - Not Available |
| CYP2C9 - cytochrome P450 family 2 subfamily C member 9 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000771.3 | 1101 | Missense Mutation | ACT,ATT | T,I 359 | NP_000762.2 | |
| XM_017015758.1 | 1101 | Missense Mutation | ACT,ATT | T,I 359 | XP_016871247.1 | |
Back To TopMore Information
Important Information
Assay C__30634131_20 detects the rare CYP2C9*4 c.1076T>C SNP, which is adjacent to the polymorphic CYP2C9*3,*18 c.1075A>C SNP that is detected by assay C__27104892_10. These two SNP assays can be used to detect the 3 possible haplotypes described for this locus (www.pharmvar.org/gene/CYP2C9; minor alleles 1076C and 1075C do not occur together in a haplotype). Run both assays separately on the same samples and analyze data as described in the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 5 section 'TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets'.
Assay C__27104892_10 interrogates the CYP2C9*3,*18 c.1075A>C SNP (rs1057910).Additional Information:
For this assay, SNP(s) [rs1057910] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance. Assay C__27104892_10 interrogates rs1057910 (CYP2C9*3/*18 c.1075A>C). For more information, refer to the assay Important Information note.
Set Membership: |
DME
Validated
Inventoried
|
Panther Classification:
Gene Ontology Categories:
Back To Top