Search
LOADING 
- SNP ID:
- rs12120541
- Gene
-
FAM132AUBE2J2 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.1: 1253615 - 1253615 on Build GRCh38
- Polymorphism:
- A/C, Transversion substitution
- Context Sequence [VIC/FAM]:
TAGCGTGTTGAGTAAACACTCTATT[A/C]GTTAGCATTCCCCCTCCCATGAGCC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 616593
|
||||||||||||||||||||
Literature Links: |
FAM132A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| FAM132A - family with sequence similarity 132 member A | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| UBE2J2 - ubiquitin conjugating enzyme E2 J2 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_058167.2 | Intron | NP_477515.2 | ||||
| NM_194315.1 | Intron | NP_919296.1 | ||||
| NM_194457.1 | Intron | NP_919439.1 | ||||
| NM_194458.1 | Intron | NP_919440.1 | ||||
| XM_005244718.3 | Intron | XP_005244775.1 | ||||
| XM_005244719.4 | Intron | XP_005244776.1 | ||||
| XM_006710333.3 | Intron | XP_006710396.1 | ||||
| XM_011540613.2 | Intron | XP_011538915.1 | ||||
| XM_011540614.2 | Intron | XP_011538916.1 | ||||
| XM_011540616.2 | Intron | XP_011538918.1 | ||||
| XM_011540617.2 | Intron | XP_011538919.1 | ||||
| XM_017000238.1 | Intron | XP_016855727.1 | ||||
| XM_017000239.1 | Intron | XP_016855728.1 | ||||
Back To Top