Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Veja todas as categorias de produtos
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30679642_10
          See other RPL9P11 GT Assays ›
          SNP ID:
          rs10864431
          Gene
          RPL9P11 SLC25A33
          Gene Name
          ribosomal protein L9 pseudogene 11
          solute carrier family 25 member 33
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.1: 9576671 - 9576671 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AACACGATCAAGGGTGTTACACTGG[A/G]CTTCTGTTACAAGATGAGGTCTGCG

          Assay ID C__30679642_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          26 submissions

          Phenotype:

          MIM: 610816

          Literature Links:

          RPL9P11 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.03)
          (0.97)
          Caucasian - Not Available CEPH (CEU)
          A (0.01)
          (0.99)
          EAS
          A (0.04)
          (0.96)
          African American - Not Available YRI (Yoruba)
          A (0.02)
          (0.98)
          SAS
          A (0.07)
          (0.93)
          Chinese - Not Available JPT (Japanese)
          A (0.06)
          (0.94)
          AFR
          A (0.02)
          (0.98)
          Japanese - Not Available CHB (Han Chinese)
          A (0.09)
          (0.91)
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          RPL9P11 - ribosomal protein L9 pseudogene 11
          There are no transcripts associated with this gene.
          SLC25A33 - solute carrier family 25 member 33
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_032315.2 Intron NP_115691.1
          XM_005263503.3 Intron XP_005263560.1
          XM_011542296.1 Intron XP_011540598.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          mitochondrial carrier protein

          Gene Ontology Categories:

          Function(s) Process(es)

          mitochondrial genome maintenance
          regulation of oxidative phosphorylation
          mitochondrial DNA replication
          transcription from mitochondrial promoter
          translation
          pyrimidine nucleotide transport
          mitochondrion organization
          positive regulation of cell proliferation
          positive regulation of cell growth
          mitochondria-nucleus signaling pathway
          cellular response to insulin stimulus
          mitochondrial respiratory chain complex III assembly
          regulation of mitochondrial membrane potential
          regulation of cell cycle arrest
          regulation of reactive oxygen species biosynthetic process
          cellular response to insulin-like growth factor stimulus
          mitochondrial pyrimidine nucleotide import
          structural constituent of ribosome
          pyrimidine nucleotide transmembrane transporter activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline