Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30761140_10
          See other FAS GT Assays ›
          SNP ID:
          rs9658785
          Gene
          FAS
          Gene Name
          Fas cell surface death receptor
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 89016577 - 89016577 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TTTGTACTTGGTGATGTGGTTTTTT[C/T]CCTCATGGCTTCACCTAGTGGCCCC

          Assay ID C__30761140_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 134637

          Literature Links:

          FAS PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.04)
          (0.96)
          Caucasian - Not Available CEPH (CEU)
          C (0.02)
          (0.98)
          EAS
          C (0.02)
          (0.98)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.05)
          (0.95)
          Chinese - Not Available JPT (Japanese)
          C (0.02)
          (0.98)
          AFR
          C (0.00)
          (1.00)
          Japanese - Not Available CHB (Han Chinese)
          C (0.03)
          (0.97)
          EUR
          C (0.04)
          (0.96)
          AMR
          C (0.12)
          (0.88)
          FAS - Fas cell surface death receptor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000043.5 3428 UTR 3 NP_000034.1
          NM_001320619.1 3428 UTR 3 NP_001307548.1
          NM_152871.3 3428 UTR 3 NP_690610.1
          NM_152872.3 3428 UTR 3 NP_690611.1
          XM_006717819.3 3428 Intron XP_006717882.1
          XM_011539764.2 3428 Intron XP_011538066.1
          XM_011539765.2 3428 Intron XP_011538067.1
          XM_011539766.2 3428 Intron XP_011538068.1
          XM_011539767.2 3428 Intron XP_011538069.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          transmembrane signal receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          ovarian follicle atresia
          immunoglobulin production
          renal system process
          protein complex assembly
          apoptotic process
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          activation-induced cell death of T cells
          inflammatory cell apoptotic process
          inflammatory response
          immune response
          signal transduction
          spermatogenesis
          brain development
          aging
          circadian rhythm
          extrinsic apoptotic signaling pathway via death domain receptors
          response to toxic substance
          gene expression
          regulation of gene expression
          B cell mediated immunity
          telencephalon development
          dendrite regeneration
          positive regulation of protein homooligomerization
          response to lipopolysaccharide
          tumor necrosis factor-mediated signaling pathway
          regulation of cell proliferation
          response to drug
          ovulation cycle
          regulation of apoptotic process
          chordate embryonic development
          positive regulation of apoptotic process
          negative regulation of apoptotic process
          regulation of cysteine-type endopeptidase activity involved in apoptotic process
          positive regulation of MAPK cascade
          response to peptide hormone
          negative thymic T cell selection
          regulation of lymphocyte differentiation
          regulation of myeloid cell differentiation
          response to cycloheximide
          spleen development
          negative regulation of B cell activation
          protein homooligomerization
          response to glucocorticoid
          maternal process involved in female pregnancy
          positive regulation of lymphocyte apoptotic process
          cellular response to hydrogen peroxide
          response to growth factor
          cellular response to phenylalanine
          cellular response to mechanical stimulus
          cellular response to cobalt ion
          cellular response to lithium ion
          cellular response to glucose stimulus
          cellular response to interleukin-1
          cellular response to estrogen stimulus
          cellular response to hyperoxia
          cellular response to hypoxia
          cellular response to hydrostatic pressure
          motor neuron apoptotic process
          apoptotic signaling pathway
          extrinsic apoptotic signaling pathway
          extrinsic apoptotic signaling pathway in absence of ligand
          hepatocyte apoptotic process
          activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway
          liver regeneration
          necroptotic signaling pathway
          regulation of extrinsic apoptotic signaling pathway via death domain receptors
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          response to fluoride
          positive regulation of extrinsic apoptotic signaling pathway in absence of ligand
          protease binding
          signal transducer activity
          receptor activity
          tumor necrosis factor-activated receptor activity
          protein binding
          kinase binding
          protein complex binding
          identical protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline