Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30871141_10
          See other B4GALT2 GT Assays ›
          SNP ID:
          rs12403036
          Gene
          B4GALT2 CCDC24 SLC6A9
          Gene Name
          beta-1,4-galactosyltransferase 2
          coiled-coil domain containing 24
          solute carrier family 6 member 9
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.1: 43991633 - 43991633 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GCTAGGGCCCTGGTTCCCACTGCCT[G/A]GTTTCTGGGCCCCCGGCATCCGAGT

          Assay ID C__30871141_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          38 submissions

          Phenotype:

          MIM: 604013 MIM: 601019

          Literature Links:

          B4GALT2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.49)
          (0.51)
          Caucasian - Not Available CEPH (CEU)
          G (0.22)
          (0.78)
          EAS
          G (0.40)
          (0.60)
          African American - Not Available YRI (Yoruba)
          A (0.09)
          (0.91)
          SAS
          G (0.34)
          (0.66)
          Chinese - Not Available JPT (Japanese)
          A (0.44)
          (0.56)
          AFR
          A (0.13)
          (0.87)
          Japanese - Not Available CHB (Han Chinese)
          G (0.48)
          (0.52)
          EUR
          G (0.27)
          (0.73)
          AMR
          G (0.41)
          (0.59)
          B4GALT2 - beta-1,4-galactosyltransferase 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001005417.2 26 Intron NP_001005417.1
          NM_003780.4 26 Intron NP_003771.1
          NM_030587.2 26 Intron NP_085076.2
          XM_017002716.1 26 Intron XP_016858205.1
          XM_017002717.1 26 Intron XP_016858206.1
          CCDC24 - coiled-coil domain containing 24
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_152499.2 26 UTR 5 NP_689712.1
          XM_017000423.1 26 Intron XP_016855912.1
          XM_017000424.1 26 Intron XP_016855913.1
          XM_017000425.1 26 Intron XP_016855914.1
          XM_017000426.1 26 Intron XP_016855915.1
          XM_017000427.1 26 Intron XP_016855916.1
          XM_017000428.1 26 Intron XP_016855917.1
          XM_017000429.1 26 Intron XP_016855918.1
          XM_017000430.1 26 Intron XP_016855919.1
          XM_017000431.1 26 Intron XP_016855920.1
          XM_017000432.1 26 Intron XP_016855921.1
          XM_017000433.1 26 Intron XP_016855922.1
          XM_017000434.1 26 Intron XP_016855923.1
          XM_017000435.1 26 Intron XP_016855924.1
          XM_017000436.1 26 Intron XP_016855925.1
          XM_017000437.1 26 Intron XP_016855926.1
          XM_017000438.1 26 Intron XP_016855927.1
          XM_017000439.1 26 Intron XP_016855928.1
          XM_017000440.1 26 Intron XP_016855929.1
          XM_017000441.1 26 Intron XP_016855930.1
          XM_017000442.1 26 Intron XP_016855931.1
          XM_017000443.1 26 Intron XP_016855932.1
          XM_017000444.1 26 Intron XP_016855933.1
          XM_017000445.1 26 Intron XP_016855934.1
          XM_017000446.1 26 Intron XP_016855935.1
          SLC6A9 - solute carrier family 6 member 9
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          glycosyltransferase

          Gene Ontology Categories:

          Function(s) Process(es)

          protein glycosylation
          keratan sulfate biosynthetic process
          beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity
          N-acetyllactosamine synthase activity
          lactose synthase activity
          galactosyltransferase activity
          metal ion binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-zdkzh:80/100.66.76.145:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline