Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GCCAGTAGATAGAGTCTTCCTGCTA[A/G]TGCGGCTGGAGGCCAGGGGTGAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 146735 MIM: 601311 | ||||||||||||||||||||
Literature Links: |
IGFBP6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IGFBP6 - insulin like growth factor binding protein 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SOAT2 - sterol O-acyltransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003578.3 | Intron | NP_003569.1 | ||||
XM_011538849.2 | Intron | XP_011537151.1 | ||||
XM_011538850.2 | Intron | XP_011537152.1 | ||||
XM_011538851.2 | Intron | XP_011537153.1 |