Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__31344336_10
          See other ANK3 GT Assays ›
          SNP ID:
          rs10994154
          Gene
          ANK3
          Gene Name
          ankyrin 3, node of Ranvier (ankyrin G)
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 60029995 - 60029995 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          ATTCCCTATGGGGTGGTTTAACATG[A/C]TGCTGCTACCTGCTAGATGCCTTAG

          Assay ID C__31344336_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600465

          Literature Links:

          ANK3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.09)
          (0.91)
          Caucasian - Not Available CEPH (CEU)
          C (0.13)
          (0.87)
          EAS
          C (0.03)
          (0.97)
          African American - Not Available YRI (Yoruba)
          C (0.20)
          (0.80)
          SAS
          C (0.07)
          (0.93)
          Chinese - Not Available JPT (Japanese)
          C (0.07)
          (0.93)
          AFR
          C (0.16)
          (0.84)
          Japanese - Not Available CHB (Han Chinese)
          C (0.08)
          (0.92)
          EUR
          C (0.08)
          (0.92)
          AMR
          C (0.07)
          (0.93)
          ANK3 - ankyrin 3, node of Ranvier (ankyrin G)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001149.3 Intron NP_001140.2
          NM_001204403.1 Intron NP_001191332.1
          NM_001204404.1 Intron NP_001191333.1
          NM_001320874.1 Intron NP_001307803.1
          NM_020987.4 Intron NP_066267.2
          XM_005269715.3 Intron XP_005269772.1
          XM_006717796.3 Intron XP_006717859.1
          XM_006717802.3 Intron XP_006717865.1
          XM_011539708.2 Intron XP_011538010.1
          XM_011539709.2 Intron XP_011538011.1
          XM_017016110.1 Intron XP_016871599.1
          XM_017016111.1 Intron XP_016871600.1
          XM_017016112.1 Intron XP_016871601.1
          XM_017016113.1 Intron XP_016871602.1
          XM_017016114.1 Intron XP_016871603.1
          XM_017016115.1 Intron XP_016871604.1
          XM_017016116.1 Intron XP_016871605.1
          XM_017016117.1 Intron XP_016871606.1
          XM_017016118.1 Intron XP_016871607.1
          XM_017016119.1 Intron XP_016871608.1
          XM_017016120.1 Intron XP_016871609.1
          XM_017016121.1 Intron XP_016871610.1
          XM_017016122.1 Intron XP_016871611.1
          XM_017016123.1 Intron XP_016871612.1
          XM_017016124.1 Intron XP_016871613.1
          XM_017016125.1 Intron XP_016871614.1
          XM_017016126.1 Intron XP_016871615.1
          XM_017016127.1 Intron XP_016871616.1
          XM_017016128.1 Intron XP_016871617.1
          XM_017016129.1 Intron XP_016871618.1
          XM_017016130.1 Intron XP_016871619.1
          XM_017016131.1 Intron XP_016871620.1
          XM_017016132.1 Intron XP_016871621.1
          XM_017016133.1 Intron XP_016871622.1
          XM_017016134.1 Intron XP_016871623.1
          XM_017016135.1 Intron XP_016871624.1
          XM_017016136.1 Intron XP_016871625.1
          XM_017016137.1 Intron XP_016871626.1
          XM_017016138.1 Intron XP_016871627.1
          XM_017016139.1 Intron XP_016871628.1
          XM_017016140.1 Intron XP_016871629.1
          XM_017016141.1 Intron XP_016871630.1
          XM_017016142.1 Intron XP_016871631.1
          XM_017016143.1 Intron XP_016871632.1
          XM_017016144.1 Intron XP_016871633.1
          XM_017016145.1 Intron XP_016871634.1
          XM_017016146.1 Intron XP_016871635.1
          XM_017016147.1 Intron XP_016871636.1
          XM_017016148.1 Intron XP_016871637.1
          XM_017016149.1 Intron XP_016871638.1
          XM_017016150.1 Intron XP_016871639.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          scaffold/adaptor protein

          Gene Ontology Categories:

          Function(s) Process(es)

          mitotic cytokinesis
          ER to Golgi vesicle-mediated transport
          plasma membrane organization
          cytoskeletal anchoring at plasma membrane
          signal transduction
          axonogenesis
          axon guidance
          neuromuscular junction development
          positive regulation of gene expression
          positive regulation of cell communication by electrical coupling
          positive regulation of sodium ion transport
          magnesium ion homeostasis
          neuronal action potential
          positive regulation of homotypic cell-cell adhesion
          Golgi to plasma membrane protein transport
          regulation of potassium ion transport
          establishment of protein localization
          positive regulation of membrane potential
          cellular response to magnesium ion
          membrane assembly
          protein localization to plasma membrane
          maintenance of protein location in plasma membrane
          protein targeting to plasma membrane
          positive regulation of protein targeting to membrane
          positive regulation of membrane depolarization during cardiac muscle cell action potential
          negative regulation of delayed rectifier potassium channel activity
          positive regulation of sodium ion transmembrane transporter activity
          positive regulation of cation channel activity
          structural constituent of cytoskeleton
          protein binding
          cytoskeletal protein binding
          cytoskeletal adaptor activity
          spectrin binding
          protein binding, bridging
          ion channel binding
          cadherin binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline