Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__31591317_10
          See other ALDH1A3 GT Assays ›
          SNP ID:
          rs12907541
          Gene
          ALDH1A3 LOC101927751 LRRK1
          Gene Name
          aldehyde dehydrogenase 1 family member A3
          uncharacterized LOC101927751
          leucine rich repeat kinase 1
          Set Membership:
          -
          Chromosome Location:
          Chr.15: 100919242 - 100919242 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          GGCCGCCGAGGGGACGCCTCGCGAC[G/T]GTTCCTGGGAGAGCTGGCGGCGGCC

          Assay ID C__31591317_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600463 MIM: 610986

          Literature Links:

          ALDH1A3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.11)
          (0.89)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.10)
          (0.90)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.03)
          (0.97)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.28)
          (0.72)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.03)
          (0.97)
          AMR
          C (0.03)
          (0.97)
          ALDH1A3 - aldehyde dehydrogenase 1 family member A3
          There are no transcripts associated with this gene.
          LOC101927751 - uncharacterized LOC101927751
          There are no transcripts associated with this gene.
          LRRK1 - leucine rich repeat kinase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_024652.4 226 UTR 5 NP_078928.3
          XM_005254979.3 226 Intron XP_005255036.1
          XM_011522012.2 226 Intron XP_011520314.1
          XM_011522013.2 226 Intron XP_011520315.1
          XM_011522014.2 226 UTR 5 XP_011520316.1
          XM_011522015.2 226 Intron XP_011520317.1
          XM_011522016.2 226 Intron XP_011520318.1
          XM_011522017.2 226 Intron XP_011520319.1
          XM_011522018.2 226 Intron XP_011520320.1
          XM_011522019.2 226 UTR 5 XP_011520321.1
          XM_017022570.1 226 Intron XP_016878059.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase scaffold/adaptor protein

          Gene Ontology Categories:

          Function(s) Process(es)

          protein phosphorylation
          small GTPase mediated signal transduction
          osteoclast development
          bone resorption
          positive regulation of peptidyl-tyrosine phosphorylation
          negative regulation of peptidyl-tyrosine phosphorylation
          positive regulation of canonical Wnt signaling pathway
          positive regulation of intracellular signal transduction
          protein serine/threonine kinase activity
          protein binding
          ATP binding
          GTP binding
          identical protein binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline