Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__31822608_30
          See other AVPR1A GT Assays ›
          SNP ID:
          rs11174810
          Gene
          AVPR1A
          Gene Name
          arginine vasopressin receptor 1A
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.12: 63146515 - 63146515 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TACCCTTGTAACACTGATCAAAATA[C/T]GTTTACAATGTCCAAGAGAAAGTCC

          Assay ID C__31822608_30
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600821

          Literature Links:

          AVPR1A PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.14)
          (0.86)
          Caucasian - Not Available CEPH (CEU)
          T (0.02)
          (0.98)
          EAS
          T (0.12)
          (0.88)
          African American - Not Available YRI (Yoruba)
          T (0.25)
          (0.75)
          SAS
          T (0.21)
          (0.79)
          Chinese - Not Available JPT (Japanese)
          T (0.12)
          (0.88)
          AFR
          T (0.26)
          (0.74)
          Japanese - Not Available CHB (Han Chinese)
          T (0.10)
          (0.90)
          EUR
          T (0.02)
          (0.98)
          AMR
          T (0.02)
          (0.98)
          AVPR1A - arginine vasopressin receptor 1A
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000706.4 4075 UTR 3 NP_000697.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          regulation of systemic arterial blood pressure by vasopressin
          maternal aggressive behavior
          positive regulation of systemic arterial blood pressure
          generation of precursor metabolites and energy
          G-protein coupled receptor signaling pathway
          activation of phospholipase C activity
          positive regulation of cytosolic calcium ion concentration
          negative regulation of female receptivity
          grooming behavior
          blood circulation
          positive regulation of cell proliferation
          positive regulation of heart rate
          positive regulation of glutamate secretion
          myotube differentiation
          calcium-mediated signaling
          telencephalon development
          positive regulation of cell growth
          positive regulation of prostaglandin biosynthetic process
          positive regulation of cellular pH reduction
          cellular response to hormone stimulus
          social behavior
          positive regulation of renal sodium excretion
          cellular response to water deprivation
          maternal behavior
          sperm ejaculation
          penile erection
          positive regulation of vasoconstriction
          response to corticosterone
          negative regulation of transmission of nerve impulse
          response to peptide
          vasopressin receptor activity
          protein kinase C binding
          protein binding
          peptide hormone binding
          V1A vasopressin receptor binding
          peptide binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-9nscr:80/100.66.75.107:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0