Search
LOADING 
- SNP ID:
- rs5030656
- Gene
-
CYP2D6LOC102723722NDUFA6-AS1 - Gene Name
- Set Membership:
- > DME > Validated > Inventoried
- Chromosome Location:
- Chr.22: 42128174 - 42128176 on Build GRCh38
- Polymorphism:
- CTT/-, Insertion/deletion
- Context Sequence [VIC/FAM]:
CCCCACCGTGGCAGCCACTCTCAC[CTT/-]CTCCATCTCTGCCAGGAAGGCCTC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 124030
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CYP2D6 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
CYP2D6*9,g.2613_2615delAGA
CYP2D6*9,g. 2615_2617delAAG; CYP2D6*9,g.2613_2615delAGA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | ||||||
|---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU) - Not Available | ||||||
EAS
|
African American
|
YRI (Yoruba) - Not Available | ||||||
SAS
|
Japanese
|
CHB (Han Chinese) - Not Available | ||||||
AFR
|
Chinese
|
JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
| CYP2D6 - cytochrome P450 family 2 subfamily D member 6 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000106.5 | 778 | Silent Mutation | NP_000097.3 | |||
| NM_001025161.2 | 778 | Silent Mutation | NP_001020332.2 | |||
| LOC102723722 - uncharacterized LOC102723722 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To TopMore Information
Important Information
Assay C__32407229_60 targets the CYP2D6*9 deletion variant, which can be denoted as g.2613_2615delAGA or g.2615_2617delAAG, results in deletion of amino acid K281. C__32407229_60 specifically amplifies CYP2D6 sequences using primers that bind to sites that differ in sequence from the CYP2D7 pseudogene. Two of these base differences occur as SNPs (rs28371721 and rs28371718) in CYP2D6*12.002,*45 and *46 alleles. These SNP minor alleles are not linked to the *9 variant and thus do not interfere with its detection. However, C__32407229_60 will not amplify samples that are homozygous for the underlying SNP minor alleles. A sample that is heterozygous for *12.002,*45 or *46 and the *9 variants will run as *9/*9 and will be heterozygous for *12.002,*45 or *46 SNPs. The *12.002,*45 or *46 alleles also include the rs28371710 SNP, which is detected by C__25628700_50 and can be used to confirm the presence of these alleles, if needed.Additional Information:
The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
For this assay, SNP(s) [rs28371721 and rs28371718] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance. For more information, refer to the assay Important Information note.
For this assay, SNP(s) [rs28371721 and rs28371718] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance. For more information, refer to the assay Important Information note.
Set Membership: |
DME
Validated
Inventoried
|
Panther Classification:
Gene Ontology Categories:
Back To Top