Search
LOADING 
- SNP ID:
- rs35742686
- Gene
-
CYP2D6LOC102723722NDUFA6-AS1 - Gene Name
- Set Membership:
- > DME > Validated > Inventoried
- Chromosome Location:
- Chr.22: 42128242 - 42128242 on Build GRCh38
- Polymorphism:
- T/-, Insertion/deletion
- Context Sequence [VIC/FAM]:
GGCTGGGCTGGGTCCCAGGTCATCC[T/-]GTGCTCAGTTAGCAGCTCATCCAGC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 124030
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CYP2D6 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
CYP2D6*3A,g.2549delA
CYP2D6*3B,g.2549delA
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | ||||||
|---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU) - Not Available | ||||||
EAS
|
Caucasian
|
YRI (Yoruba) - Not Available | ||||||
SAS
|
African American
|
CHB (Han Chinese) - Not Available | ||||||
AFR
|
African American
|
JPT (Japanese) - Not Available | ||||||
EUR
|
Japanese
|
|||||||
AMR
|
Japanese
|
|||||||
Chinese
|
||||||||
Chinese
|
| CYP2D6 - cytochrome P450 family 2 subfamily D member 6 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000106.5 | 712 | Frame Shift Delete | AGG,GGA | R,G 259 | NP_000097.3 | |
| NM_001025161.2 | 712 | Frame Shift Delete | AGG,GGA | R,G 208 | NP_001020332.2 | |
| XM_011529966.2 | 712 | Intron | XP_011528268.1 | |||
| XM_011529968.2 | 712 | Intron | XP_011528270.1 | |||
| XM_011529970.2 | 712 | Intron | XP_011528272.1 | |||
| XM_011529972.2 | 712 | Intron | XP_011528274.1 | |||
| LOC102723722 - uncharacterized LOC102723722 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| XM_017029174.1 | 712 | Intron | XP_016884663.1 | |||
| NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To TopMore Information
Important Information
An improved version of C__32407232_50 to CYP2D6*3,g.2549delA is available; we highly recommend using the new C__32407232_L0 assay. Two SNPs, rs28371719 and rs17002852, underlie C__32407232_50 primer binding sites. In the presence of either of these SNPs, amplification of chromosomes that carry the rs35742686 wild type allele is reduced. The underlying SNPs are not linked to the *3 variant and do not interfere with *3 detection, however, C__32407232_50 will not amplify samples that are homozygous for the rs28371719 or rs17002852 alternate alleles, and samples that are heterozygous for these SNPs and the *3 allele will run as *3/*3. The C__32407232_L0 assay does not overlie rs28371719 or rs17002852.Additional Information:
The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
For this assay, SNP(s) [rs28371719] is located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance. For more information, refer to the assay Important Information note.
For this assay, SNP(s) [rs28371719] is located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance. For more information, refer to the assay Important Information note.
Set Membership: |
DME
Validated
Inventoried
|
Panther Classification:
Gene Ontology Categories:
Back To Top