Search
LOADING 
- SNP ID:
- rs72549353
- Gene
-
CYP2D6LOC102723722NDUFA6-AS1 - Gene Name
- Set Membership:
- > DME > Validated > Inventoried
- Chromosome Location:
- Chr.22: 42128249 - 42128252 on Build GRCh38
- Polymorphism:
- -/AGTT, Insertion/deletion
- Context Sequence [VIC/FAM]:
GGGTCCCAGGTCATCCTGTGCTC[-/AGTT]AGCAGCTCATCCAGCTGGGTCAGG
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 124030
|
||||||||||||||||||||||||||||||||
Literature Links: |
CYP2D6 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
CYP2D6*19,g.2539_2542delAACT
|
||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | |||
|---|---|---|---|---|---|
| Global - Not Available | Caucasian
|
CEPH (CEU) - Not Available | |||
| EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | |||
| SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | |||
| AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | |||
| EUR - Not Available | |||||
| AMR - Not Available |
| CYP2D6 - cytochrome P450 family 2 subfamily D member 6 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000106.5 | 702 | Silent Mutation | NP_000097.3 | |||
| NM_001025161.2 | 702 | Silent Mutation | NP_001020332.2 | |||
| LOC102723722 - uncharacterized LOC102723722 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To TopMore Information
Additional Information:
The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
Set Membership: |
DME
Validated
Inventoried
|
Panther Classification:
Gene Ontology Categories:
Back To Top